Jupiter's Daughter
by
Tom Hyman

ALSO BY TOM HYMAN Prussian Blue Seven Days to Petrograd Rices and Honor
The Russian Woman Giant Killer VIKING Published by the Penguin Group
Penguin Books USA Inc 375 Hudson Street, New York, New York 10014,
U.S.A.

Penguin Books Ltd, 27 Wrights Lane, London W8 STZ, England Penguin
Books Australia Ltd, Ringwood, Victoria, Australia Penguin Books Canada
Ltd, 10 Alcorn Avenue, Toronto, Ontario, Canada M4V 3B2

Penguin Books (N.Z.) Ltd, 182-190 Wairau Road, Auckland 10, New Zealand
Penguin Books Ltd, Registered Offices: Harmondsworth, Middlesex,
England First published in 1994 by Viking Penguin, a division of
Penguin Books USA Inc.  Copyright (c) Vernon Tom Hyman, 1994

All rights reserved Library of Congress Cataloging-in-Publication Data
Hyman, Vernon Tom.

Jupiter's daughter / Tom Hyman.

p. cm.

ISBN 0-670-84116-1

1. Mothers and daughters--Fiction.  2. Twenty-first century- Fiction.

3. Genetic engineering--Fiction.  I. Title.

PS3508.Y49J87 1994

813'54--dc20 93-34889

Printed in the United States of America Set in Sabon Designed by Katy
Riegel Without limiting the rights under copyright reserved above, no
part of this publication may be reproduced, stored in or introduced
into a retrieval system, or transmitted, in any form or by any means
(electronic, mechanical, photo copying, recording or otherwise),
without the prior written permission of both the copyright owner and
the above publisher of this book.

To Nona and Bill My special thanks go to molecular biologist ack
Greiner.  for his generous advice and help on all matters scientific,
especially the dauntingly complex subject of genetics.

l New Year's Day, 1999

I: Millennium 5

II: Valley of the Lost Genes 165

III: Homo Sapiens Rex 341

It had snowed all night, and the acres of fields and woods around the
big house were covered with a thick, perfect blanket of white.

The sun's light, low in the southern sky, reflected off the snow with a
blinding brightness, but there was no heat in it.  The departed storm
had left the air clear and bitterly cold.

Anne Stewart practiced the piano all day.

She played to dispel a slight hangover from the previous night's
champagne, and a deep, inexplicable melancholy that accompanied it.

She had started practice at nine o'clock in the morning.

It was now past three in the afternoon, and she remained intent at the
keyboard, striving to induce her fingers to reproduce the difficult
chords demanded of Mozart's Sonata No.  5 in G Major.

The room she practiced in, located in the south wing of the
forty-eight-room Stewart mansion on Long Island's North Shore, was
large and sunny, with tall windows on three sides.

Anne Stewart was twenty-six years old and a woman of exceptional beauty
and grace.  Her husband, Dalton Stewart, was away on business in the
Caribbean.  In the two years and three months that they had been
married, he had been away much of the time.

Anne was left alone on the estate, with twelve full-time servants and
little to do.

Despite her youth and the enviable circumstances of her surroundings,
she considered her life to be at a virtual dead end.  Her depressions,
at first fleeting, had in recent months come to cloud the entire day,
making sleep difficult and the rounds of social duties her marriage
required next to unbearable.  Lately she had begun to wonder if she
might be slipping into madness.

Only her music still had the power to lift her spirits.  She could
still enter into it with her whole being, place herself into an almost
trancelike state of bliss that momentarily dissolved the reality around
her.

But the hours of practice were taking a physical toll.  Her back ached,
and her wrists and fingers were stiff and sore from the thousands of
times they had pressed the keys.  She dropped her hands down at her
sides and gently flexed her wrists to relax the muscles.

She gazed absently across the room in the direction of the big glass
door that separated the music room from a larger, rarely used sitting
room, cluttered with ornate, overstuffed Victorian pieces that had been
in the house since the day it was built, a hundred years ago.

A girl of three or four years of age was standing on the other side of
the door, with one hand pressed against the glass.  The late-afternoon
winter sun, slanting through the big windows of the music room,
reflected off the glass of the door and partially obscured the girl's
features, but there was no mistaking her presence.  She was smiling at
Anne with an expression of the most intense delight.  Her blond curls
had a blue ribbon tied in them, and she was wearing a perfectly pressed
white cotton summer dress with a blue satin ribbon around the waist.

Her smile was loving and completely familiar, with a hint of mischief
in it, as if she were about to say something she knew Anne would think
funny.  Yet Anne was quite certain she had never seen her before.  The
girl's luminous eyes glowed with intelligence and pleasure.  Anne
supposed that she had been attracted by the sound of her piano
playing.

The sudden, inexplicable presence of the child filled Anne with an
almost giddy sensation of joy.  It was as if someone she loved
tremendously had just returned after a long absence.  Anne laughed,
then stood up and hurried to the door, to invite the girl in.

Jupiter's Daughter ù 3

But the moment she turned the doorknob, the girl vanished.

Anne stood motionless, her hand gripping the knob.  She was afraid to
breathe.

After an uncertain passage of time, she stepped back from the door.

She began trembling violently.  Her sense of elation evaporated into
confusion.  She moved slowly across the room, studying the glass in the
door from different angles, but the image of the girl did not
reappear.

She had imagined it.

It didn't seem possible.  In her mind's eye she could still picture the
child perfectly, could still feel that oddly familiar smile.  If it was
an hallucination, its effect was overwhelmingly real.

Anne closed her eyes and shook her head.  What could account for such a
powerful illusion?  Was it just some peculiarity in the light, combined
with her fatigued mental state?  Perhaps she had stayed too long at the
piano, she thought.  It had put her in an impressionable mood.  She
knew that such things could happen.

Minds played tricks sometimes.

She sat a few minutes longer, watching the now pale, watery sun sink
behind the bare branches of the trees that lined the fields on the
southwest side of the house.  The daylight faded and the room grew gray
and chilly.  She closed the cover on the keyboard and left.

The image of the beautiful child lingered with her for weeks,
magnifying her frustration and her unhappiness.  She began to think of
the incident as some kind of premonition, and the thought haunted
her.

She knew she could never have any children with her husband.

And yet she felt absolutely certain that the child she had seen-or
imagined she had seen--was her own.

The Road of the Mountain Guns curled up the steep hill behind the
Caribbean city of Coronado in a series of four hairpin turns.

At the top of the hill stood the ruins of an old Spanish fort, whose
gun emplacements had once guarded the harbor below.

The ancient fort and the corroded, moss-covered remains of the great
bronze cannons had not so long ago been tourist attractions; but a
decade of neglect had undermined large stretches of the road's surface,
and bandits were said to lurk in the heavy roadside undergrowth, ready
to pounce on the unwary traveler.  Few people used the road these days,
and those who did climbed it only for the most compelling reasons.

A man named Joseph Cooper had just such a reason.  And as he made his
precarious way around the giant potholes and deep, boulder-strewn
washouts, he kept that strong sense of purpose foremost in his mind.

Cooper's skin was the darkest ebony.  Everything else about him was as
white as the midday Caribbean sun: his hair, his beard, his tennis
sneakers, and the bleached, baggy shorts and voluminous shirt that
flapped about his skinny trunk like a flag around its pole on a windy
day.  His bosses in Washington called him Mr. Stare, for the habitual
dreamy, far-off expression in his sad eyes.

Half an hour before dark he reached the walls of the old Spanish fort
at the top and paused to wait for the cover of nightfall.

He watched the sun touch the western rim of the Caribbean.  The ocean
darkened to a deep purple and lights began winking on in the city
below.  They sparkled against the carpet of land like diamonds on black
velvet.  For these few minutes of tropical twilight, Coronado hid its
destitute circumstance beneath an enchanted glow.

Cooper climbed down from the fort parapet and hurried through the
encroaching darkness.  The road continued a short distance beyond the
ruins to a cluster of one-story brick buildings spread out on a wide,
grassy hilltop plateau.  The place had once been the campus of the
Antilles Medical School.  Abandoned by its American owners fifteen
years earlier, the school had sat empty until five years ago, when the
American doctor took up residence there.

Everything of value had long since been stripped from the premises.

What remained had been left to the birds, the insects, and a profusion
of tropical plants and vines that grew over the brick and tile surfaces
and crept through the broken windows like green mold spreading across
old bread.  The once tended lawns, flower gardens, and brick walkways
had deteriorated into a jumble of vacant lots, choked with tall weeds,
broken glass, and rubbish.

Lights burned in the building the doctor used for his laboratory.

Cooper peeked in a window.  The doctor was sitting at a bench on the
far side of the room, pouring some liquid into a test tube.

For several minutes Cooper crouched by the window, watching.

Then, from his shirt pocket, he removed an electronic eavesdropping
device the size and shape of a tenpenny nail and wedged it deep into
the soft, rotting wood at the bottom of the window's frame.  He
installed a second bug in another window, then pulled a miniature
transmitter-receiver from another pocket and tested the bugs.  The lab
was so quiet Cooper could not tell for several minutes if they were
working.  Then the doctor dropped something.  Cooper heard it
perfectly.

He hid the transmitter-receiver under the eaves of the roof.  It would
relay the sounds of the lab directly to a satellite in high earth
orbit, which in turn would relay them to a recording device in a small,
locked room at the sprawling thousand-acre complex of the National
Security Agency in Fort Meade, Maryland.

Dr. Harold Goth held the test tube up to the light and examined the
contents.

The tube was warm--exactly blood temperature.  A few ounces of a thin,
cloudy broth swirled against the glass walls.  The mysterious soup was
a rich mix of nutrient chemicals and bacteria cells.

The cells, some billion of them, were multiplying rapidly, doubling in
number every twenty-four hours.

The doctor picked up a rotor lying on the bench, locked the test tube
into one of the four slots on the arm, then slipped the rotor into
place on the shaft of a small centrifuge.  He set the timer on the
machine and turned it on.  With a low, intense hum the apparatus began
whirling the tube faster and faster, until the cloudy liquid was being
rotated at five thousand revolutions per minute.

Dr. Goth permitted himself a quick little smile.  Despite the strain
and fatigue of the past several months, he still felt that familiar
excitement he had for so long associated with the handson practice of
scientific routine.

After thirty minutes the centrifuge shut itself off.  Goth retrieved
the rotor and removed the test tube from its slot.  Its contents had
undergone a visible transformation.  Centrifugal force had driven the
cells to the rounded bottom of the tube, where they formed a compacted,
gray-yellow mass.  Goth poured off the now clear nutrient liquid from
the top, added a small amount of fresh nutrient, and attached the tube
to a mechanical shaker.  The shaker broke up the pellet of cells at the
bottom and caused it to mix with the new nutrient.  A cloudy broth
formed once again, thicker than before.

Goth removed the tube from the shaker, set it in a holding frame, and
pulled the stopper from the top.  Using a thin, hollow plastic rod
called a pipette, he added to the soup carefully measured amounts of
two chemicals--ethylenediamine tetra-acetate, or EDTA, and sodium
dodecyl sulphate, or SDS.  The EDTA would weaken the membrane walls of
the cells in the solution by removing their calcium and magnesium
ions.

The SDS would dissolve the molecules of fat from those same cell walls,
causing them to collapse and spill the cells' innards into the broth.

He shut the test tube in an incubator preset at 98.6 degrees Fahrenheit
and glanced up at the clock on the far wall.  Twenty minutes past
nine.

It would take forty-five minutes for the chemicals to do their work.

Dr. Goth removed his wire-rimmed spectacles and wiped them with the
bottom edge of his lab jacket.  He had worked so very hard these last
few months--sixteen to eighteen hours a day, every day, with barely a
break.  The effort had taken its toll.  His eyes ached persistently,
and he had trouble focusing.  Periods of faintness and exhaustion were
becoming more frequent and more prolonged.  Even now, as he slipped his
glasses back over his ears, his hands shook from the effort.  When he
stood, his legs trembled beneath him.

He forced his tired muscles into motion and stepped outside the
laboratory for some *esh air.  The moon was just rising.  It cast a
broad path of silver light across the Caribbean waters below.  A
tropical breeze was blowing in from the west.  He inhaled deeply.

The island was in many ways a beautiful place, blessed with an idyllic
climate and topography.  Yet Goth did not love it here.  He loathed the
corruption and incompetence of the local government.

He detested the laziness and insolence of the native population.

He despaired of their poverty and their ignorance.  But most of all, he
hated the isolation.  He was far from everything that was important to
him.  He was here not by choice but by a perverse twist of fate.  He
dreamed of the day he would leave the island forever and resume his
place among the great scientists of the age.

When forty-five minutes had passed, the doctor returned to the lab and
removed the test tube from the incubator.  The membrane walls of the
billion cells that had turned the mixture cloudy were now dissolved.

The liquid was clear again.  It was also viscous-about the consistency
of egg white--and sticky to the touch.

Goth poured in a small amount of ethanol and rocked the test tube
gently back and forth in his hand to mix it with the liquid.

The transparent solution began turning gray.

He returned the tube to the centrifuge and let it spin for another half
hour.  When he removed it the second time, the changes were dramatic.

The ethanol, heavier than the liquid, had settled to the bottom.  On
its way down it had killed all the protein in the cells and caused it
to precipitate out of the mixture.  The protein now formed a white,
coagulated band just above the ethanol.

Using a pipette with a bent tip, Goth painstakingly removed, one drop
at a time, the clear, sticky liquid remaining at the top of the test
tube and deposited it in a separate tube.  He then poured a small
amount of pure alcohol into the tube with it.  The alcohol floated on
top of the liquid.  He plunged a thin glass rod through the alcohol and
into the mixture and then slowly withdrew it.  As the rod broke the
surface, it carried with it, suspended from its tip, a long,
glistening, gossamer filament.

Goth pushed his glasses up on his forehead and brought the rod up
closer to his eyes.  In the lab's flickering fluorescent light the
filament glittered wetly, like a thread of translucent fiber.  He held
his breath, lest his exhaled air disturb it.

The minute filament was composed of hundreds of thousands of individual
strands, each vanishingly thin--a few ten-billionths of a millimeter in
diameter--and visible by themselves only under the powerful
magnification of an electron microscope.

They were fragments of cloned human DNA.

The visible presence of the miracle substance could still, after all
these years of intimacy, make the doctor tremble with pleasure.

DNA--deoxyribonucleic acid.  Entwined in the form of a double helix
within the nucleus of the human cell, it carried the genetic code of
life, the instructions that defined the form and behavior of every
living plant and creature on earth, from the single-celled protoplasm
to Homo sapiens.

Dr. Goth had dedicated his career to the study of this code.  He was
closer than anyone had yet come to a complete understanding of the
immensely complex series of functions and interrelationships that DNA
had scripted for the many thousands of genes that determined the
genetic destiny of every human being.

Goth could now alter the script for many of those genes, and by so
doing, rewrite the basic instructions that governed human life
itself.

Such an extraordinarily wide-ranging capability, not thought to be
within the reach of microbiologists for decades, had elevated Goth to a
unique and lonely position.

He was experimenting in the forbidden zone of the biological sciences:
the so-called germ line--the DNA of the human reproductive system.

His quest had been prolonged and difficult.  The controversial nature
of his work had made it impossible to continue to finance his research
through the normal channels of government and academic grants.  Indeed,
most countries had passed explicit laws banning any kind of tampering
with the human germ line; and even in those countries where it was not
strictly illegal, it was widely regarded as unethical and dangerous.

No major biologic or medical scientific research facility in the
world--commercial, governmental, or academic--dared involve itself with
the germ line.

In order to keep his project alive, Goth had exhausted his own personal
wealth and resorted to increasingly desperate measures of austerity.

His original staff of six assistants was now reduced to one, and needed
supplies and equipment had to be done without.  Harassment and spying
by government authorities had forced him twice to move his clinic to a
different country, costing him precious additional amounts of time and
capital.

Despite everything, he had persevered.  And he knew the goal he had
struggled toward for so long was now, at last, tantalizingly near.

With the eavesdropping devices in place, Joseph Cooper moved quickly
from the lab across the dark, weed-choked campus to a small brick
outbuilding.  The windows were boarded up with thick planks and
reinforced with steel bars.  The building's one door was
triple-locked.

He took out a penlight from his pocket and shined it on the locks.

There were two pin tumblers and one Medeco high-security--well within
his range of expertise.

From his back pocket Cooper extracted a small leather pouch.

It contained a set of eleven basic lock picks that he had fashioned
himself from strips of flat, cold-rolled steel, one-fiftieth of an inch
thick, and three varieties of tension tools made from thin strips of
spring steel.

He attacked the top pin tumbler first.  He inserted a tension tool into
the keyhole and slid it along the bottom of the keyway as far as it
would go.  Next he selected a pick with a serrated top and bottom,
called a rake, and slipped it into the keyway above the tension tool.

He applied a slight clockwise turning pressure to the tension tool and
then, grasping the rake, yanked it back out of the keyhole with a
quick, controlled motion, to bounce the tumbler pins back up past the
plug's sheer point.  The tension tool twisted the cylinder to the
right, free of the pins that had held it in place, and the latchbolt
slid back out of the strike box and inside the lock housing.

The second pin tumbler took longer.  It appeared to be a newer lock,
and the tumbler pins wouldn't "bounce."  Using a narrow pick with a
bent end, and keeping a slight but steady clockwise pressure with the
tension tool, he patiently felt out and lifted each pin past the sheer
line.  When he had raised the last, the plug turned and unlocked.

Predictably, the Medeco gave him the most trouble.  He had not had a
lot of practice with this type, and its design required that he employ
two picks simultaneously at different angles on each pin to raise it.

Holding the penlight in his mouth and steadying his hands against the
door with his little fingers, he struggled for ten minutes before the
lock finally yielded to his finesse.

Cooper opened the door cautiously and played the light around.  Inside
was a long, windowless storeroom.  Shelves of large glass jars lined
both walls.  The air was heavy with the stale odor of formaldehyde.

Cooper walked slowly along between the rows, flicking his narrow beam
of light back and forth.  The jars glowed a ghostly, transparent
amber.

Each one contained the remains of a human baby.  Some were
fetuses--physically grotesque ones, with missing body parts, gross
skeletal abnormalities, enlarged or distorted features, excess numbers
of limbs, and other defects not apparent to Cooper's untrained eye.

But many of the jars held what appeared to be newborn infants.  Some
were white; most were black.  They were intact and looked relatively
normal.  Stillborn, he guessed.

Each jar was labeled with cryptic information that he couldn't
decipher.  Only the dates were apparent to him.  The contents of some
jars were ten years old.  The newest was dated from eighteen months
earlier.

For the next hour Goth busied himself preparing the strands of DNA for
sequencing.  He removed tiny amounts of the DNA-rich liquid from the
test tube with a micropipette and mixed them in several small glass
vessels with a series of biochemicals called dideoxy compounds.  He
then placed the vessels into a series of wells at the top of a
sequencing apparatus, a clear plastic slab containing a thin gel
sandwiched between sheets of glass.

When he was satisfied that everything was in order, he turned on the
sequencer's heating element to start the separation, a process that
would take all night to complete.  In the morning the gel, with its
newly acquired coating of the DNA-rich broth from the vessels, would be
hardened into a plasticlike sheet.  Goth would remove the sheet, treat
it with special chemicals to fix it, and then expose it to X-ray
film.

The film would make visible about four hundred base pairs along a
segment of the DNA, whose sequence he could then read.  He would need
to repeat this process sixty times to get a readout of the entire
strand of DNA that concerned him.  It was an outdated, time-consuming,
and laborious method, but in his reduced circumstances he had no other
way to do it.

He checked the thermostat that regulated the temperature of the
sequencer to make certain that it was operating properly.  A faulty
mercury switch in an earlier one had ruined several gels and cost him a
week's work.

Goth cleaned up the work area, picked up a folder containing the day's
notes, and extracted the RCD--the removable cartridge disk--from the
computer.  He locked the folder and the hard disk in a cheap vinyl
attache case, turned off the computer and the lights, and left the lab,
carrying the case with him.  There was nothing more he could do until
the morning.

He knew he was very close now.  These results would have to be tested
and retested, confirmed and reconfirmed, before he could lay all
lingering uncertainties to rest.  But he was close.

He locked the lab door and retreated down the narrow corridor to the
small pair of rooms in the back of the building that he had converted
into living quarters.

He removed a small cotton blanket from an ancient floor safe that sat
in one corner of his bedroom, opened the safe, and slid the attache
case in alongside stacks of his research notes and a backup copy of the
RCD.  He closed the door and spun the dial to lock it again.

He had been thinking a lot about his future these past few weeks.

Fifteen years ago, he had stood on a stage in Stockholm in a rented tie
and tails and received the Nobel Prize in biology.

He was only forty-five--one of the youngest scientists ever to have
received the prize.  How his spirits had soared that day-how invincible
he had felt.

Would he ever again be so rewarded for his achievements?  He knew it
was unlikely, at least in his own lifetime.  And yet the research for
which he had won that Nobel Prize paled in significance next to his
present work.

It was only months after receiving the prize that he began his work on
the germ line.  No one had supported his effort.  On the contrary,
everyone had condemned it.  His colleagues had warned him that it would
be professional suicide.  His friends had deserted him, and so had his
wife of twelve years, herself a prominent geneticist.

But Goth was not dissuaded.  His motivations were complicated, but one
reason dominated all others: the simple glory of the quest.  He saw a
unique chance to make an extraordinary contribution to science and to
the future of the human race.

Someday, he thought, his accomplishments would set him apart as a man
of the ages, as a name to be spoken in the same breath as Mendel or
Pasteur, or even Einstein.

He stepped to the window and pulled back the edge of the shade.  The
medical school's deserted buildings looked like a ghost town in the
moonlight.  Behind them loomed the crumbled towers of the old Spanish
fortress.

Goth folded back the sheet of the narrow cot that had been his bed for
the last five years and slipped under it.  He looked at the two novels
on the small steamer trunk he used as a night table.

Both were Sherlock Holmes pastiches.  He had read them once and found
them thin; nothing, unfortunately, compared with the master.  But he
had read Arthur Conan Doyle through so many times over the past decades
that he knew all the Holmes stories by heart.  It was a shame there
were no more.  They had been his only escape from reality.

He took in a deep breath and let it out in a long, ragged exhalation of
exhaustion and despair.  There were stark realities to be faced.  He
needed money desperately.  He was half a million dollars in debt.  He
had long ago liquidated all his possessions.

And no one he knew of--no individual, no institution--was willing to
extend him any more credit.  If he did not get some financing soon, he
would have to close the lab and abandon his work.

Eventually, somebody somewhere else would make the same discoveries he
had made and reap his rewards--and his immortality.

His effort would be wasted.

And his dream would die.

Goth removed his glasses, folded them carefully, and placed them beside
the books on the steamer trunk.  He turned out the light and lay back
against the pillow, his eyes wide, his brain far from sleep.

There was only one possible way he could think of to get the money he
needed.  The thought of it made him shudder with disgust.  But he
really had no choice.  He would have to do it.

Cooper pulled a small point-and-shoot camera from his pants pocket,
checked the film, adjusted the flash, and began firing away.  He moved
quickly along the rows of jars, crouching and shooting, until he had
photographed everything in the storeroom.

The 35 mm lens took in a wide field, but the camera was loaded with a
special high-density black-and-white film whose negative could be
enlarged tenfold with no loss of definition.

Cooper would normally use several rolls of film and photograph
everything two or three times, just to cover himself against any
possible failure.  But a nameless menace seemed to lurk in the thick,
foul air.  After only one roll Cooper began to tremble and sweat.

He started to reload and then gave up.  He jammed the camera back in
his pocket and bolted out of the shed.  He fumbled in haste to relock
the door and then fled across the grounds of the medical school back
toward the Road of the Mountain Guns.

The moon cast a dim, shadowy light on the road's rutted surface.

Cooper descended as fast as he dared, trying to shake the images of
those jars of human fetuses from his mind.

From what Dalton Stewart had seen so far, Dr. Harold Goth's research
center was a huge disappointment.  Stewart had expected to find a
modern facility, with state-of-the-art technology and dozens of
white-frocked technicians watching computer screens.

Instead there was this rundown collection of rooms with broken floor
tiles, dirty windows, and ancient equipment, housed insile a decaying
single-story brick structure which had not seen a coat of paint, a
repointed brick, or a roof repair in over a decade.

The center had once been a medical school, Stewart had learned--one of
those offshore diploma mills that used to crank out second-rate
American doctors before it lost its accreditation back in the
mid-eighties.

The only other individual on the premises besides Goth appeared to be a
short, perpetually frowning dark-haired female lab assistant who didn't
look old enough to have finished high school.

Stewart followed the four other visitors into a cluttered, dimly lit
laboratory.  The research assistant was busy in a far corner, fiddling
with something on a counter top.

Five folding metal chairs, their seats blistered with rust, had been
arranged for the visitors in a semicircle facing a battered oak school
desk.  The desk was buried under a haphazard pile of computer printouts
and dog-eared books and manuals of every size and description, their
pages bristling with reference markers made from torn shreds of
paper.

Stewart brushed off the seat of the chair nearest the door and

20

sat down on it.  There was no air conditioning, and the oppressive heat
was made all the more stifling by the accumulated odors of chemicals,
mildew, and human sweat.  He pulled a white cotton handkerchief from
his pocket and patted his brow.

Stewart was the principal owner of Stewart Biotech, a conglomerate of
chemical and biological manufacturing and research facilities.  He was
forty-six years old, tall and trim.  His dark, handsome face and
self-confident smile had graced the covers of many magazines, from
Fortune and Forbes to Time and People.

He was a modern American success story.  From a small, debtridden Long
Island drug supply house he had bought with some money borrowed from an
uncle, he had built an empire.  It was a tribute to his skill at
self-promotion that his personal net worth was estimated variously to
be anywhere between one billion and three billion dollars.  In fact, he
was worth considerably less than a billion.  How much less depended on
the day of the week and the month of the year, because his fortune was
in a constant state of flux.  Like many entrepreneurs, he was an
active, high-stakes gambler whose plunges could win or lose him
millions every week.  Even the banks who backed his financial
adventures never knew for certain how much money he had.

Whatever his actual wealth, he was widely admired as a businessman with
drive and imagination.  His energy and enterprise --and his flair for
publicity--had won him an international reputation and many powerful
friends.  Wherever he went, he was accustomed to making his presence
felt.  He projected an enormously appealing image of strength, charm,
and sophistication.

Despite all these outward manifestations of success, Stewart was not a
particularly happy man.  He had been married three times, and he had no
children.  Behind the dashing, worldly image lurked an apprehensive,
hungry soul, pursued by childhood insecurities and cravings that no
amount of success seemed able to still.

At this precise moment, Stewart felt especially unhappy.  He was
beginning to suspect that he had made a dumb mistake coming here.

But still, he was curious.  Dr. Harold Goth was one of the world's
greatest biologists.  Or at least he had been.  The file put together
by Stewart's research department in New York presented a picture of a
brilliant scientist in decline.  As a leading figure in the fields of
molecular biology and genetics, Goth had held important positions at
three of the most prestigious universities in the world.

He had written two books on genetics that were regarded as classics.

He was also responsible for developing several breakthrough laboratory
procedures and held a patent on a special apparatus he had invented to
speed up the process of gene splicing.  In 1984 he had been awarded the
Nobel Prize in biology.

But like many men of genius, Goth was a maverick--a man who preferred
to pursue his own goals.  He was single-minded, egotistical, and
contemptuous of anyone who disagreed with him.

Former colleagues who had once admired his work thought that in the
last decade he had lost his way.  Others thought him simply
power-mad--a man who had let his ego and his greed for renown get in
the way of his responsibilities as a scientist.

Stewart's file showed Goth's problems becoming serious in 1992.  He had
publicly condemned a new law passed that year by Congress banning
genetic experimentation with the genes of the human reproductive
system--the so-called germ line.  His defiance cost him his university
teaching post and all the funding for his research.  He moved his
laboratory to Switzerland and raised enough money there to continue his
work.  But two years later controversy caught up with him again, and
Switzerland sent him packing.

So here he was, Stewart thought, a fugitive--cast up on an impoverished
Caribbean island, flat broke and desperate for help.

Under the circumstances, Stewart reflected, it was a tribute to Goth's
still-powerful reputation that he had been able to command the presence
of the five individuals who now sat in the stale tropical heat of his
grubby little lab, waiting to hear what he had on his mind.  Like
Stewart, the other visitors were all enormously successful
international financiers and industrialists, and all were heavily
invested in biotechnology, one of the more cutthroat areas of modern
business competition.

Stewart glanced down the row of chairs.  His four companions wore
varying expressions of boredom and discomfort.  It amused him to see
them in such modest surroundings, stripped of their usual protective
layers of advisors, assistants, and bodyguards.

Goth had been adamant--he would allow no one inside his laboratory or
his office except the five principals.  To make the humiliation
complete, he had hired two local department-store guards to search each
of them for weapons and recording devices.

In the chair next to Stewart sat the Kuwaiti prince Bandar, clad in a
floor-length white dishdas7a and a white kufiyya, held on his head by a
twisted length of black cord.  He had a nervous habit of pushing back
the edge of the cloth with his fingers, like a woman brushing back long
tresses.

Bandar was easily the richest of the five.  His worth was
stupendous--in excess of $100 billion.  But the prince's wealth,
derived from the huge oil reserves under his country's desert, was an
accident of birth and geography, not the results of risk, intelligence,
or hard work.  The prince was childish, vain, and selfindulgent.  He
knew or cared little about business affairs.  He hired others to do his
work for him.

Goth had been smart to invite the prince, Stewart reflected.

Bandar controlled a fortune so vast that even his sybaritic excesses
could not deplete it.  Underwriting Goth's research would be as
insignificant an expense to him as throwing loose change to a beggar.

And the prince's requirements for what he got in return would probably
not be demanding.

In the next chair over from Bandar was Harry Fairfield, the British
pharmaceuticals tycoon.  Redheaded and ruddy-faced, Fairfield was a
cockney from the London docks who had started his business career at
sixteen as a drug runner for an East End gang.

He punched and kicked and shot his way to the top of the drug trade,
and by the early 1970s he was making millions wholesaling heroin and
cocaine.  In the eighties, weary of the building pressures from both
the police and his rivals, he elected to get out of crime before he was
either sent to prison or killed.  He invested his profits in legitimate
drug companies and eventually made himself respectable.

Despite his new image, Fairfield's business tactics remained something
of a holdover from his drug-dealing days.  If the normal strategies
didn't work, he didn't hesitate to use muscle or threats to intimidate
his competitors.  Beneath a veneer of British working-class
respectability, Fairfield was a shrewd and primitive brute, the English
equivalent of a Mafia don.  He was disliked and feared throughout the
industry.

Next to Fairfield sat Yuichiro Yamamoto, a Japanese industrialist whose
companies were involved in a broad range of hightech ventures, from
computers to cybernetics to space vehicles.

Yamamoto was probably the most cultured and urbane of the group.  A
handsome, diminutive man in his early forties, he spoke fluent,
accentless English, dressed elegantly, and displayed a connoisseur's
taste in everything from food and wine to art and music.  He had been
educated in the United States and England, and unlike many of his
Japanese counterparts, he understood the Western mentality--and knew
how to take advantage of it.  Yamamoto was married to a relative of the
Japanese royal family and had many powerful friends in that country's
top business, social, and governmental circles.  It was expected that
he might one day run for prime minister.

Genetic engineering was a subject of interest not only to Yamamoto, who
owned a company that manufactured human insulin and other
genetics-based drugs, but also to the Japanese government, who saw it
as the next great technology frontier-one in which they were determined
to grab the lead.  Yamamoto's presence here, Stewart suspected,
represented not only his own interests but his government's as well.

On the far end, her straight ash-blond hair falling so perfectly that
it looked as if it had been ironed in place, sat the Gerrr.an baroness
Gerta von Hauser.

The baroness was dressed, rather incongruously, in a white tennis
outfit, complete with eyeshade, sneakers, and ankle socks.

Stewart suspected that the baroness was the kind of person who left
nothing to chance, so he supposed the tennis togs were a tactic on her
part to demonstrate that she didn't take this meeting very seriously.

It was just a diversion for hen-something she was managing to squeeze
in between matches on the groomed grass courts at the National Palace,
where she was staying as a guest of the island's president, Antoine
Despres.  Stewart was not fooled.  The baroness would not have traveled
all the way to Coronado for a game of tennis, even with the president
of the country.  She was here for business.

Gerta von Hauser was in her mid-forties but looked younger.

Vigorous exercise, careful diet, and the energetic attentions of an
army of stylists, masseuses, pill doctors, and cosmetic surgeons had
seemingly frozen her aging process in place.  There were a few furtive
wrinkles around her eyes and throat that betrayed her true age, but few
people ever got close enough to her to see them.

She had acquired the title of baroness eighteen years earlier through a
brief marriage to the Baron von Holwegg, a doddering Junker aristocrat
more than three times her age.  He slipped in the bathtub and killed
himself two months after their marriage.  One of his servants claimed
he was roaring drunk at the time; others swore that the baroness had
arranged it.  In any case, she reverted to her maiden name, von Hauser,
but kept her dead husband's title.  This violated both German law and
custom, but no one ever challenged her on the matter.

Dalton Stewart gazed at her long, tanned, well-muscled legs and
wondered if the sexual aura she projected wasn't also a facade.

The woman was so totally immersed in her business interests that he
doubted she had time for anything else.  Among her legendary triumphs
was her bargain-basement buy-up of major oil, chemical, and nuclear
industries throughout Eastern Europe in the wake of the communist
collapse.  In the space of less than a year (and amid unsubstantiated
rumors of bribes and blackmail) she had made Hauser Industrie, A.G the
dominant economic force in Poland, Romania, Bulgaria, the Czech
Republic, Slovakia, and the Balkan states.  In the years since, the
financial benefits of that conquest had been enormous.

The baroness's formidable position in the international business
community had an interesting history.  She had inherited a dark
legacy.

Like the Krupps, the Hausers had been for many generations one of the
most powerful families in Germany and Europe.  Gerta's
great-grandfather had manufactured the mustard gas Germany used in
World War I; her grandfather had used slave labor in his factories to
build the V-1 and V-2 rockets Hitler launched against Britain.  Gerta's
father, Wilhelm von Hauser, had been an officer in Hitler's
Waffen-SS.

He was convicted of war crimes in 1946.  After serving one year of a
forty-year sentence, he was released by the Allies to help rebuild
postwar West Germany.  He quickly reassumed control of the family's
business interests, and by the mid-sixties he had built Hauser
Industries into the largest privately held company in Europe.

Baroness Gerta had succeeded her father to the company's top post ten
years ago.  Her ascent had been highly improbable.  The Hausers were
conservative Prussians, with a very traditionalist view of a woman's
role.  But Gerta was an only child.  Her father had been desperate for
a male heir, but her mother had been unable to have any more children
after her.

Despite Gerta's early and strong interest in the business, her father
refused to take her seriously.  She got his attention, finally, by
using some of her inheritance money to buy controlling interest in one
of Hauser's competitors--a company that Hauser had almost succeeded in
putting out of business.  Within five years Gerta had turned the other
company around and forced her father to buy her out to prevent her from
annihilating his own subdivision.

Part of that buyout involved giving his daughter a prominent role in
the running of Hauser Industries.

Then Wilhelm von Hauser had a stroke that left him paralyzed from the
neck down.  His daughter quickly took charge, and he died shortly
after.  In the decade since, she had increased the company's profits
enormously.

Her success was undeniable but not uncontroversial.  Rumors abounded,
for example, that she persistently evaded German laws to sell
third-world dictators chemical alld nuclear weapons technology.

Despite public complaints from business rivals, and some charges
brought by zealous prosecutors, she had never received more than a few
small fines from the courts, for minor offenses like the illegal
dumping of toxic waste.

Two years ago, the baroness had acquired a large German

pharmaceuticals company and a biogenetics laboratory.  This accounted
for her presence here today.  If Harold Goth had made some big
breakthrough in genetic engineering, Gerta von Hauser obviously wanted
to know about it.

Stewart found it hard to take his eyes off the woman.  The baroness
seemed to have it all--beauty, intelligence, wealth, social position,
and enormous influence.  Beyond that, there was her reputation as
someone who made underlings cower in fear and business opponents run
for cover.  Could she really be so tough?

Stewart wondered.  He couldn't help wondering what a sexual encounter
with her might be like.  The exotic perfume she was wearing teased his
nostrils.  His wife, Anne, was much younger and more attractive, but
the baroness exuded a peculiarly tantalizing sense of mystery and
danger.

A screen door slammed behind them, snapping Stewart out of his
reverie.

Dr. Harold Goth strode rapidly into the room, looking neither to the
right nor to the left.  He stepped behind the desk and focused his
attention on a stack of papers sitting there.

He looked the part of the dedicated scientist, Stewart reflected --even
a caricature of one.  He was a frail, stoop-shouldered man with the
owlish, blinking manner of some nocturnal creature uncomfortable in the
full light of day.  His face was slack and pale.

Blue veins pulsed visibly through the translucent skin on his
forehead.

Skinny, hairless white limbs protruded from his shirt and shorts.

Sparse tufts of gray hair clung to his balding scalp like weeds trying
to grow from a rock.  The bridge of his eyeglasses had a small strip of
dirty white tape wrapped around it.

The doctor was carrying what appeared to be a medical supplies
catalogue in his hand.  He placed the catalogue on the desk in front of
him and looked at his visitors for the first time since entering the
room.  He dispensed with the formality of even a short welcoming
statement.

"I'm a scientist, gentlemen," he declared abruptly, "not a salesman."

Dalton Stewart stole a glance at the baroness.  Her lower lip was
curled in an expression of mild amusement.  He wondered if Goth had
annoyed her with his catch-all "gentlemen" salutation.

The doctor turned and with a jerky sweep of an arm took in the room
around him.  "Don't let my modest surroundings color your judgment
concerning the ultimate value of the work I've been doing here," he
warned.  "You know my reputation.  You know the value of my
contributions to the field of genetics.  I consider the project I am
engaged in here to be more than just important.  I consider it to be
urgent.  Therefore I have not wasted my limited time or resources on
trivialities like paint and furniture."

Stewart suppressed a grin.

"Fortunately," Goth continued, "most genetic research does not require
either a great deal of high-tech equipment or space.

Most of everything I need--centrifuges, incubators, autoclaves,
chemicals, lab supplies, microscopes, computers, and so on--I have
right here in these few rooms.  Some of my equipment is admittedly
hand-me-down, but it's adequate."

Stewart doubted it.

"Much of the work of microbiology today is done on a computer.  The
hardware I have here is not the best or the fastest available, but I've
managed to get by with it.  The software I use are either existing
programs I have modified and improved, or ones of my own creation.  As
for data, much of that I've also developed myself.  And what I don't
have right here is within easy reach of my modem and fax machine.  This
puts all of the world's genetic databases at my disposal.  Beyond that,
I can access thousands of volumes from dozens of scientific
libraries.

The fact remains, however, that with newer, more sophisticated computer
hardware, I could do a lot more and do it much faster.  That new
computer equipment would cost about forty thousand dollars."

Goth paused for a moment and stared out the window to arrange his
thoughts.  Prince Bandar flicked the cloth of his kufiyya out of his
face and yawned noisily.  A fly alighted on Stewart's cheek; he brushed
it away.  The baroness crossed her legs and began pumping her foot back
and forth impatiently.  Fairfield, looking terminally bored, leaned
back and stretched his arms over his head.  Yamamoto sat motionless,
watching the doctor with an alert, attentive gaze.

"I have reached a critical stage in my research," Goth said, turning
back to his select little audience.  "The primary work has been done.

All the necessary breakthroughs have been made.

What remains is the painstaking but absolutely necessary task of
checking and testing and retesting all the data.  This takes time.

And it takes money--money that I regrettably do not have."

Goth leaned a hip against his desk and picked up the catalogue he had
placed there earlier.  He opened it to a page marked with a paper clip
and held it up.  "Consider this little instrument," he said, pointing
to a full-page color advertisement for some piece of scientific
equipment.  "It's called a PCR--a polymerase chain reactor.  It
replicates trace quantities of DNA.  Having one would save me many
hours of tedious labor.  There are no secondhand ones available.  A new
one costs ten thousand dollars."

Dr. Goth opened the catalogue to another page.  It showed a pair of
beige boxes, somewhat larger than the PCR.  "This is an ALPS automatic
DNA sequencer.  Hooked up with the proper computer equipment and
program, it can sequence large segments of DNA.  It can do in a few
minutes what it'd take me days to do with the old X-ray gel method.

And it's far more reliable.  It costs a hundred and twenty-five
thousand dollars."

The doctor closed the catalogue and dropped it back on the desk.

"There is other equipment I could use as well.  Beyond the additional
equipment I also need financial backing to carry my work from the
experimental stage to the stage of practical application.  This means
expanding the facility here and hiring more staff.  With the added
help, I could complete this last stage of my project in about a year's
time."

Stewart shifted in his chair.  What the hell was this secret project?

Was Goth just building the suspense, or was he actually reluctant to
tell them?

"As you know," the doctor continued, "I have chosen to work in an area
of genetics considered taboo in many societies.  As a result, I've had
to put up with obstacles beyond those required of my research.  Lack of
funds.  Bureaucratic harassment.  Professional ostracism.  Ridicule and
libel from the media.  Even sabotage and death threats from religious
crackpots and political extremists.

Yet I've continued on in the face of all this because I know the value
of my work far outweighs any dangers or inconveniences I might face
personally."

The unsettling thought crossed Stewart's mind that Goth's secret might
be some wildly impractical fantasy.  Years of research without results
often encouraged a certain type of scientist to start seeing
breakthroughs where none existed, to start making rash claims about
discoveries not supported by his work.  Delusions of grandeur were an
occupational hazard for aging scientists, and Goth seemed to be showing
some of the symptoms.

"What I believe I have accomplished, gentlemen," Goth said, "is, on one
level, quite simple to describe."

Stewart leaned forward in his chair.  Silence gripped the room.

"I've developed a better human being," he said.

Anne Stewart walked down the brick path that led from the main house to
the guest cottage.  She wore a white dress and carried a picnic basket
under her arm.

It was an unusually warm day for early March.  The sky was crystalline,
the air sweet with the smells of early spring.  The lawns, free of snow
since the first week in February, were already pale green with fresh
growth, and the forsythia bushes were putting forth their first yellow
buds.

The lawn sloped away from the main house, an Italianate stone mansion
of forty-eight rooms, in a broad apron many acres in size.  To the
north it stretched a thousand yards to the edge of Long Island Sound,
where it enclosed a shallow cove of sandy beach.  A large boat house
dominated one end of the cove.  To the east, south, and west, the
landscape was an artful blend of gardens, stone walls, hedgerows,
ponds, and small groves of trees.

Beyond the immediate grounds lay hundreds of acres of fields, and
beyond the fields was a deep border of forest--a small wilderness that
effectively hid the estate from view, except from the waters of the
sound.

The property, built by an oil baron at the turn of the century, was
landscaped to re-create, insofar as such a thing was possible, the mood
he claimed to have experienced while strolling the grounds of
Versailles: an overwhelming sense of tranquillity and permanence.

At Anne Stewart's side was Alexandra Tate, a neighbor who had, in the
two and a half years since Anne's marriage to Dalton Stewart, become a
close friend.  She carried a portable ice chest with two bottles of
white wine.

The euphoric glory of the day had so far failed to improve Anne's
mood.

The dispirited gloom that she had felt through most of the winter still
clung to her.  She counted heavily on Lexy Tate's company to cheer her
up.

The two women reached the guest house, a small Tudor-style cottage with
vine-covered brick-and-wood walls and leaded glass windows.  They
stepped onto the terrace and looked around.  On one side was a small
duck pond ringed with lacy green boughs of hemlocks; on the other, a
grove of maples, their branches still bare of leaves.

"Gorgeous," Lexy declared, taking in the view with a broad,
encompassing sweep of her arms.  "Paradise.  This is it, right here."

Anne deposited her picnic basket on a big wrought-iron table, pulled
out a chair, and sat down heavily.

Lexy propped a foot up on the stone parapet that enclosed the
terrace.

"Do you know what that word really means, by the way?"

"What word?"

" 'Paradise' !  " Anne shrugged.  "Besides heaven, it also means a
park.  It's from the Latin paradisus.  And/or the Greek paradeisos."

Lexy's mouth fell open.  "How did you know that?"

"You told me.  About six months ago."

"Did I?  Christ, I must be getting Alzheimer's.  Did I also tell you
who told me?"

"Maybe not."  Anne Stewart extracted a paper napkin from the picnic
basket and began wiping away a sticky yellow coat of tree pollen that
had accumulated on the table's glass surface.

"It was a guy I dated one summer when I was sixteen.  He was a freshman
at Princeton, and I was very impressed with him.  An intellectual.  His
father wanted him to go into investment banking, but he planned to
devote his life to poetry and booze.  One night we ended up on the
local country-club golf course.  We wandered around the fairways in the
moonlight with a bottle of vodka while he laid this paradisus line on
me.  The gist was that since we were, in effect, already in heaven out
here on the golf course, that anything we did would probably have the
Lord's blessing.  I thought it was a pretty good argument, so I went
along with it."  Lexy came over to the table and sat down across from
Anne.  "We fucked our brains out on the fourteenth green."

Anne nodded absently.  She continued to scrub the tabletop, pressing
down with such force that the table's wrought-iron legs began rattling
noisily on the stone terrace.

"I thought it was a kind of funny story," Lexy said.

"I'm sorry.  You did tell me," Anne replied.

Lexy sighed and watched Anne in silence.  Finally, she leaned across
the table and grabbed her friend's wrist, stopping her in mid-wipe.

"Are you compulsive about dust, or do you just harbor a secret desire
to be a cleaning lady?"

Anne flushed in embarrassment.  She released her grip on the paper
napkin.  "Sorry."

Lexy screwed up her face in a scowl and flicked a wrist at the napkin,
as if it were a bug to be shooed away.  It fell to the terrace floor.

"If you're really so concerned about the dirt, you should go right over
to that phone and call the housekeeper.  Tell her the table on the
guest house terrace is filtly beyond description, and she had better
send someone down to clean it, immediately."

Anne slumped back in her chair.  "Oh, for godsakes, Lexy, I could never
do that."

"You could too do it," Lexy insisted.

"I can't boss people around.  It's not in my nature."

"You don't have to boss anyone around.  You just have to be firm.

You're letting the staff here get away with murder."

"Is this another lesson from you in upper-class manners?"

"If you like."

"Honestly, if it were up to me, I'd fire them all.  I hate servants.

I hate to be waited on.  The whole idea offends me."

"Why isn't it up to you?"

"What do you mean?"

"If you really want to fire them, then why can't you?  Maybe that's
exactly what you should do.  Let a few heads roll.  And I'd start with
your housekeeper, Mrs.  Corley--the Wicked Witch of the West Wing."

"I've already tried.  Dalton won't let me.  'Mrs. Corley's been with
the family for twenty years.  Can't do without her."

" "You can't let Dalton push you around, either.  He has to let you run
the household.  And Mrs. Corley hasn't been with the family twenty
years.  It's more like four.  Before that, I think, she was an
assistant warden at some maximum-security correctional facility
upstate."

Anne shook her head.  "He won't talk about it.  Mrs. Corley's supposed
to be showing me the ropes."

"Well, all she's doing is contriving ways to make you look stupid."

"She's very good at that."

"Boy, you really are in a down mood.  You need some wine, quick."  Lexy
pulled a bottle from the ice chest and fished around inside the picnic
basket for a corkscrew.  "You can't let a few problems in the ranks
spoil your day."

Anne took out silverware, plates, glasses, and linen napkins from the
basket and arranged two place settings on the table.  "It's not just
about the staff.  It's everything.  I'm depressed all the time
lately.

And I'm not the kind of person who gets depressed.  At least I didn't
used to be."  She pulled a plate of sandwiches out of the basket,
removed the transparent wrap covering them, and then slammed the basket
lid closed.  "I'm just not cut out for this life, Lexy."

Alexandra popped the cork on the wine bottle with an energetic tug and
filled the glasses to the brim.  "Don't be a defeatist.  Once you get
used to it, you'll love it.  I promise.  You'll get on top of things
eventually."

"I don't think I can stand another week.  Who lives like this
anymore?

In a forty-eight-room house bulging with servants?  Nobody, except
heads of state--and maybe a few dotty old society matrons."

"Dalton likes to impress people," Lexy replied.

"You don't think much of him, do you?"

Lexy changed the subject.  She picked up a sandwich and eyed it
critically.  "Did you make this yourself?"

Anne looked puzzled.  "Of course."

"I could tell."  Lexy fingered the sandwich as if it were a small
animal that might bite her.  "The bread still has the crust on it."

"You don't like crust?"

"I love crust--on pizza and apple pie.  You should've let Amelia
prepare the lunch.  She's the cook.  You may think that you're being
Little Miss Helpful by barging into the kitchen and making these all by
yourself, but what you're really doing is invading her territory.

Humiliating her.  You're telling her that you can do a better job than
she can, even at something as dumb as making sandwiches."

"Amelia's a terrific cook," Anne protested.  "And she knows it.

I didn't want her to have to fuss with our little lunch.... Now you're
making me feel really terrible."

Lexy took a bite of the sandwich, then hoisted her glass.  "Let's get
drunk."

Anne shook her head.  "I've got a committee meeting this afternoon.

We're organizing a charity fund-raiser for some innercity
children...."

"Fuck the fund-raiser.  The committee ought to mind its own business,
anyway.  Enjoy life.  Drink your wine."

Anne took a sip and made a face.

"What's the matter?"

"It tastes bitter.  What is it?"

Lexy laughed.  "It's a forty-five-dollar bottle of white Bordeaux.

And it doesn't taste bitter.  It tastes dry."

"I'll never get beyond beer and vodka tonics."

"At least you didn't say wine coolers."

"Do you really love this life, Lexy?  You put it down all the time."

Alexandra Tate hunched her shoulders and turned her palms up in a comic
exaggeration of a shrug.  "I don't know anything else.  I was born
rich.  I make fun of it just to keep some perspective.  A lot of it is
stupid, pretentious, hypocritical, and boring.

But I like the privileges.  I'm a spoiled brat at heart."

"Well, I wish there were more spoiled brats around like you.

You're the only friend I have these days."

"Oh, come on, Annie.  Stop feeling so sorry for yourself."

"Everyone treats me like a leper.  Haven't you noticed?  Dalton's
family and friends included.  Especially Dalton's mother.  If it was
possible to be snubbed to death, I'd have been done in months ago."

"Give it some time.  And don't take it so seriously.  And Dalton's
mother is the last person in the world who should snub you.

Before she married Dalton's father, she worked in a massage parlor.

And she didn't give massages."

"That's not true."

"Yes, it is."

"But why does everyone hate me so?  It's incredible.  Do they really
think I'm so inferior in breeding and background that they can't even
tolerate my presence?"

"It doesn't have as much to do with social class as you think."

"What does it have to do with?  I've tried very hard to be nice to
people.  I really have."  Anne's voice broke.  She felt on the verge of
tears.

"Annie.  Listen.  To the people around here you're an outsider.

You grew up somewhere else--you went to different schools and different
parties.  You had different friends.  These people all grew up
together.  They've all had the same experiences.  They share the same
values.  Pretty boring, but that's the way it is.  It's tribal.

Selfprotective.  You'd get the same treatment if you moved into Little
Italy, or a Jewish neighborhood in the Bronx, or a dinky little hamlet
in New England.  Close-knit people are intolerant and suspicious of
outsiders."

"It can't be that simple."

"You're right.  The Stewarts are still considered parvenus by the Old
Guard, for one thing.  And of course all the women are terrified of
you."

Anne gaped at her friend in genuine astonishment.  "Terrified of me?"

"Sure.  You're too good-looking.  They're jealous.  And they think
you're after their husbands."

"That's completely ridiculous!"

"I know, I know, but don't play dumb.  You're a threat, whether you
intend to be or not.  Look at you--twenty-six years old, long
strawberry-blond hair, peaches-and-cream complexion, soft sexy voice,
big blue bedroom eyes, a gorgeous face with a cute dimpled chin, a
smile that could melt the Antarctic ice pack, and a body that should be
legally classified as a lethal weapon."

Anne laughed."  'Bedroom eyes'?"

"You have star quality--that indefinable, mysterious
whateverthe-hell-it-is that makes you irresistible to any man with even
trace amounts of testosterone in his blood.  Even Giorgio, my gay
decorator friend, told me he's in love with you.  You're a knockout."

"Stop it, you're embarrassing me.  And you're more interesting and
sexier than I am, anyway."

Lexy shook her head firmly.  "No.  I have fat ankles and no boobs.  And
I sweat easily.  I have to be sexy and interesting as all hell just to
stay in the chase.  You're in a different class altogether.

I'm jealous of you myself."

"But the bottom line is I'll never be accepted here."

Lexy waved the idea away with a lazy flick of her wrist.  "Don't even
think about it.  Because you don't need to be 'accepted."  It doesn't
mean anything."

"Dalton thinks it does."

Lexy refilled their glasses.  "Well, if it all gets too unbearable, you
can always walk away from it."

"How can I?  Dalton expects me to live up to the role."

"Do you love him?"

Anne thought about it for a moment, then sighed.  "God, I don't know
anymore."

"Well, Dalton just threw you into all this without any warning or any
help.  It's going to take time.  If you really don't want to put in the
time, you should just take your piece of the Stewart pie right now and
split."

"What are you talking about?"

"Divorce.  And your share of the estate."

"I signed a prenuptial agreement."

"Yeah?  What's in it?"

Anne hesitated; she wasn't sure it was a good idea to share the
details, even with Lexy.  "Basically it's a million dollars .  . . if
there are no children...."

Lexy banged her wineglass down all over the glass surface.  It hit with
a sharp crack, spilling liquid all over the glass surface.

"A million dollars?  That's what you get?  Are you joking?"

Anne felt a surge of guilt.  "You think it's too much?"

Lexy rolled her eyes, stuck out her tongue, and clutched her stomach.

She scraped her chair back across the terrace and pushed herself to her
feet.  She staggered around the terrace in an operatic exaggeration of
someone taken violently ill, flinging her arms out and lurching
drunkenly from side to side.

Anne laughed out loud.  Lexy finished her performance by leaning over
the edge of the terrace and pretending to throw up in the bushes.  She
returned to the table, wiped her mouth with her napkin and gulped down
half a glass of wine.  "Did you ask me if I thought it was too much?"

she said.  "Is that what you asked me?"

"That's what I asked you."

"Well, Jesus, Mary, and Joseph, Anne--Dalton's worth over a billion.

He's one of the richest men in the country--in the world!

A million dollars is an absolute criminal outrage.  It's nothing for
Dalton Stewart.  Why did you ever agree to it?"

Anne flushed.  "A million dollars is a fortune to me.  And what right
would I have to take Dalton's wealth?  It's his.  He earned it.

I didn't."

"He didn't earn it, Pollyanna.  Nobody ever earns a billion dollars.

That's not humanly possible.  He stole it.  It's called high finance.

Or investment banking.  Or venture capitalism.  But it's actually more
like grand theft.  Normally it wouldn't be legal, but at Dalton's level
normal doesn't apply."

"That's very cynical."

"Realistic.  Money--if you have enough of it--turns the normal workings
of society on its head.  People get bought, seduced, intimidated, and
crushed.  And laws get ignored.  Or they get rewritten."

"You make business sound like organized crime."

"Right.  The only difference is the businessmen use lawyers and paper
instead of hit men and bullets.  Most of them, anyway."

"That still doesn't make it okay for me to take it from him."

"Why not?  Dalton Stewart took it from someone."

Anne Stewart crossed her arms.  "Let's change the subject."

"Listen to me," Lexy continued.  "If word ever gets out that Dalton got
you to agree to a prenuptial with a pathetic milliondollar payoff,
you'll be able to hear people laughing as far away as New Zealand.  You
were suckered.  If I were you, I'd get a lawyer to take a look at that
agreement right now, and see if he can't break it."

"No, damn it.  I stand by what I said.  I don't care where it came
from, I don't want to take Dalton's money.  I'd have a hard time
accepting the million."

"At least show the agreement to a good divorce attorney.  I know just
the guy.  I dated him a few times--" "I'm not planning a divorce."

"Okay, okay.  I was just--" "Just shut up and pour me some more of that
terrible-tasting wine I'm supposed to think is so great."

Lexy topped off Anne's glass.

"Why is everything always about money?"

"Nobody can think of anythir g more interesting."

"I can."

"What?"

Anne looked into her wineglass.  "Kids.  A happy family."

"Kids?  Is that what you want?"

"Don't look so surprised.  That's why I got married."

Lexy shrugged.  "So have some.  I think you've got space in the house
for a nursery."

"Don't you want to have children someday?"

"No.  I'm too selfish and spoiled.  I like the fucking part okay, but
it's all downhill after that.  Nine months of fatness, morning
sickness, maternity clothes, and labor pains, and then you segue right
into spitting up, messy diapers, food on the floor, and temper
tantrums.  It's not an attractive scenario.  I'm just not the mother
type, I'm afraid.  I've never met a three-year-old I genuinely
liked...."

Anne wasn't listening.  She felt a sudden flood of anger.  "I gave up a
careen-or at least the promise of a careen-to marry Dalton and have
children.  But he lied to me.  We can't have any."

"You never told me that."

Anne sank back against the chair.  The wine had loosened her
inhibitions, and she had to share her misery with somebody.  "And he
won't let me go back to work.  He wants me to spend the rest of my life
playing the piano and smiling and making small talk with his friends
and business associates.  I think he sees me as a business asset.  Just
another of his acquisitions.  He needed something young and female and
cute to run his household, carve out a prominent niche for him in
society, and make his male friends jealous of him.  Someone who'd stay
home and not interfere too much in his life.  That was supposed to be
me.  We really have nothing in common.  Our lives barely even overlap
anymore.  He's away six months of the year.  And when he's around, he
pursues his own interests.  He doesn't like anything I like--music or
science.  Or literature or the theater or the opera.  He claimed he
did, but he doesn't.  He likes business.  He sees it as a kind of
modern version of the hunt.  A blood sport.  It occupies all his
time.

It's what gets him excited.  The smell of money.  He can never have
enough.  He lusts after it.  You ought to hear him go on about it
sometime.  It's quite amazing."

Anne picked up the wineglass and stared into it.  "He also likes other
women.  I've learned to ignore it.  If I bring it up, he just denies it
and says I'm too jealous and possessive.  The affairs never seem to
amount to much.  It's just constant screwing around.  Picking up women
in London or Paris or Rome or Berlin or Philadelphia or wherever his
business takes him.  Having a good time here, there, and
everywhere--rewarding himself for all his hard work."

"Christ, you never told me any of this."

"It's been building up."

"You think he still loves you?  At all?"

"I don't know.  He used to say he did.  He doesn't anymore.

And I don't ask him.  So I don't really know what he feels anymore.

All I know is that we've become a big disappointment to each other."

A prolonged silence greeted Goth's announcement.

The doctor stuck out his chin defiantly.  "You're skeptical, of
course," he muttered.  He folded his arms across his bony chest and
leaned against the cluttered bookcase behind his desk.  "You five, of
all people, with your experience in the marketing of applied genetic
engineering, shouldn't be so incredulous.  You all know that altering
human genes has become a routine procedure, carried out every day in
hospitals and clinics all over the world.

Genetic engineering has come a long way since the eighties, when they
first synthesized human insulin."

A fly landed on Goth's arm.  He ignored it.  "Many kinds of diseases,
from high blood pressure to cancer, now yield themselves to gene
therapy.  And other, more benign abnormalities can be repaired as
well.

Genetically produced human growth hormone, for example, is not only
employed to cure dwarfism, it's used cosmetically--to add inches to a
normal person's height.

Anything that can be traced to a defect in a gene, or a group of genes,
can, in theory, be cured.  And in genetics these days, theories are
rapidly becoming realities."

Goth continued in this vein for some time, expanding upon the
increasing role that recombinant DNA was playing in everyday life: how
plants had been genetically engineered to better resist disease and
drought and still produce more and better-tasting food; how cattle had
been engineered to produce more beef on a diet of less grass; how most
of the major hereditary diseases-Tay-Sachs, sickle-cell anemia,
Huntington's chorea, cystic fibrosis, among others--could now be
screened and the defective genes responsible for the anomaly
repaired.

Stewart felt his mind begin to wander.  He glanced across at the
others.  The prince had folded his arms and slumped back in his
chair.

Fairfield was cleaning his fingernails with a pocket knife.

The baroness was still rocking her foot back and forth.  Only Yamamoto
seemed to be paying full attention.  He sat rigid in his chair, hanging
on Goth's every word.

The doctor began striding back and forth behind his desk, punctuating
his remarks with hand gestures.  "The one area where the miracles of
genetic engineering have not been applied is to the human reproductive
system," he said, his brittle voice suddenly strong with passion.  "And
the reasons are obvious.  Modifying the genes of one human being
changes only that individual.  When he dies, the altered genes die with
him.  But if one alters the basic DNA sequences in a fertilized egg--a
zygote containing both parents' chromosomes--then the changes become
immortal.  They will manifest themselves in that individual and all
that individual's future offspring.  And these changes will in turn be
passed on down to the children of that person's children, and their
children's children, for generations to come.  And if the genetic
alterations are effective ones--ones that contribute to survival--then
those who inherited them will thrive and multiply."

Goth stopped pacing and turned to face his small audience.

"This frightens many people.  Change is always frightening.  And
changes in the human germ line bring into play one of the most powerful
forces of nature--that of evolution itself."

The scientist gazed over the heads of his listeners.  "I am the only
researcher in the field of genetics working in this forbidden area," he
said, biting out his words slowly.  "My reasons for doing so are
compelling ones, but I won't bore you with them.  Suffice it to say, I
am now able to engineer a series of genetic alterations in the human
embryo that will produce some very marked improvements."

Goth picked up a sheet of paper from the desk, consulted it for a
moment, and then put it back down.

"My procedure will essentially do three things," he said.  "First, it
will raise the intelligence quotient by a factor of one.  This means
that a child destined by its genes to have an average IQ of one hundred
will instead have an IQ of two hundred.  That's well into the highest
range of genius.  Obviously such a change will make a profound
difference in any child's prospects in life."

The biologist had everyone's full attention now.

"Second, the child will enjoy an exceptionally high level of health and
physical fitness.  Its muscle strength will be increased by a factor of
between point two and point three.  That doesn't sound like much, but
it would make a young girl as powerful, pound for pound, as a fully
developed male athlete.  It would put the average male into the
championship weight-lifter class.  Further, there'll be no physical
deformities, no inherited diseases.  No insanity.  The immune system
will have the highest resistance to all forms of pollution and
disease.

Health will be superb.  This individual should seldom, if ever, fall
ill throughout its entire life.

And that life expectancy, given our present diet and living conditions,
will be one hundred and twenty years, conceivably more."

Yamamoto let out a small gasp of astonishment.  The baroness shook her
head in disbelief.  Stewart didn't know what to think.

He doubted that what Goth was saying was possible.

"In the near future I expect to be able to bring many new areas under
control.  All those inherited genetic factors specific to the parents,
for example--patterns of baldness, color blindness, height, weight,
color of skin, eyes, and hair--shape of facial features, breast size,
metabolism rate, and so on.  Eventually, in fact, it will be possible
to fine-tune the procedure so that parents will be able to choose all
of a child's attributes, from its physical appearance to its
personality.  I've already mastered the knowledge and techniques
required for all these modifications, but they're largely cosmetic.

They can wait."

Goth paused.  A pleased, triumphant grin lit his sallow face.

"One final thing my procedure will do," he said.  "It will enhance the
child's five senses--increase the range and acuity of its sight,
hearing, smell, taste, and touch.  You can well imagine how this will
heighten its awareness and understanding of the world around it, and
how much this will enrich its life."

The doctor came around from behind his desk and stood directly in front
of his five seated visitors.  "The technical biological details for how
these things are accomplished are naturally quite complex," he said.

"Only another geneticist could understand them fully.  I must
emphatically state, however, that what I am describing to you is not
science fiction.  All the techniques I've developed and refined to
accomplish the enhancements I've just mentioned are either already
being employed in some other form somewhere else, or can be quickly
learned by any competent biotechnician.  For that reason, I have taken
great precautions to keep my work secret."

The doctor's voice took on a harder edge.  "But my work is not yet
complete.  As I've already explained to you, I need a considerable
amount of money to complete this project.  I estimate ten million
dollars just to clear my outstanding debts and finance a year's worth
of additional research.  More may be required beyond that.  I can't
predict precisely what the final cost may be.

But I can predict one thing.  There isn't a potential parent on the
face of the earth who wouldn't do almost anything--pay almost
anything--to get for their future offspring what I will soon be able to
offer them."

Finished with his pitch, the doctor leaned against the edge of his desk
and looked expectantly at his guests: "Questions?"

The baroness immediately challenged him.  "What you say you'll soon
have to offer is in fact illegal to sell."

Goth nodded.  "Of course it is.  In Germany.  In England.  Japan.

The United States.  In many countries.  But not everywhere.  Not here,
for example.  That's why my lab is here.  It's an inconvenience, but
not a serious one.  As long as the research and the clinical
procedures--gene alteration and implantation--are done here, there's no
roblem.  It isn't against the laws of any country for its citizens to
travel here to have such things done."

"What about your assistant?"  the baroness asked.  "How much does she
know about your program?"

"Kirsten?  She's been with me for two and a half years.  She's well
acquainted with it."

"Can you trust her?"

Goth looked pained.  "Of course I can trust her," he snapped.

"How do you know?"

Goth considered the question impertinent.  He ignored it and pointed
his finger at Fairfield.

"What's the drill, then?"  the Englishman demanded.  "What do we get
back for our lolly?  A happy glow?  Believe me, mate, I don't need any
more charitable contributions for my tax returns.

Inland Revenue's already got their fingers up my ass."

The doctor gritted his teeth at the Englishman's vulgarity.

"Those who finance me will share in the profit when the procedure is
marketed.  And I have no doubt those profits will be immense."

"Do you expect us to form a consortium?"  the baroness asked.

"What do you mean?"

"Do you expect us to invest in you as a group?"

Goth threw out his hands.  "I suppose that's up to you.  I invited the
five of you hoping that at least one of you would agree to underwrite
my project.  If more than one wishes to be involved, that's fine.  I
must warn you, however, that if any of you contemplate sending down a
fleet of lawyers to nitpick, then you can forget it.  I've already
drawn up a very simple contract form.  It's only a few hundred words
long.  I'll give you each copies to study.

I'm amenable to reasonable changes, but I'm not amenable to letting any
of you try to tie me up with yards of red tape and hundreds of pages of
legal mumbo-jumbo.  The intent of that tactic is obvious--to take
advantage of the other party."

"Lawyers are necessary to draw up the legal documents," the baroness
replied coolly.

Her command of English was excellent, Stewart thought--and embellished
with a charmingly Germanic lisp, particularly when she pronounced her
r's.  Their eyes met briefly.

Goth folded his arms across his chest.  "I insist this be done on my
terms."

Yamamoto had the next question.  "I can understand, Doctor, how you
might have perfected your genetic techniques to enhance IQ, health, and
longevity--and even physical strength.  But your claim to be able to
expand the ranges of the senses--how is that possible?  I thought such
capacities were very limited in the human genome.  Where do you get
your model for this?"

Goth nodded.  "I'm not just repairing defective genes, or bringing
ordinary ones up to the human optimum.  In some cases I'm adding new
ones."

"How can you do that?"

"I'd prefer not to say anything more on the subject."

Yamamoto shook his head in disbelief.  He followed up with another
question.  "We all know that everyone's genome is different.  Everyone
is a special case.  How can you have devised a single formula that will
achieve the same results with two very different embryos?  " "An
intelligent question," Goth admitted.  "I have devised a software
program--a very complex program that requires a very large operating
environment.  Once an embryo's genome has been deciphered, this program
scans the genome's three billion base pairs and determines the genetic
alterations necessary to achieve those results you just
mentioned--superior intelligence, health, physical strength, and
sharper senses.  The program can cope with the widest variations.  It
won't convert them all to the same thing, but it can bring them up to
within a narrow range.  I might add that the active DNA in one human
genome differs from another by only a minute fraction of one percent.

Most of the DNA in our chromosomes is, as you probably know, silent.

Long sequences may differ from individual to individual, but they don't
do anything.  They don't code for any proteins; they don't control or
regulate anything.  They're filler.  Junk.  Good only for purposes of
genetic fingerprinting."

"Does this program of yours have a name?"  Yamamoto asked.

A sheepish grin transformed the doctor's normally stern face.

"Yes.  It's called Jupiter--after the Roman god."

"Does this .  . . Jupiter program actually carry out the genetic
alterations itself?"  Yamamoto asked.

"No.  It produces the blueprint--the final correct readout of base
pairs.  The actual reordering of the embryo's DNA structure has to be
done the old-fashioned way--in the lab.  But of course most of this
procedure is now computer-driven also.  Like space flight, it wouldn't
be humanly possible otherwise."

Dalton Stewart spoke up.  "What we've heard is quite fascinating,
Doctor, but a big problem still remains--at least for me."

"And what is that?"

"So far you've shown us no evidence that Jupiter actually works.  How
do you know it does?  Have you performed any trial runs?  Do you have
any test results of experiments done on real people?  We can hardly
accept your say-so on something as farfetched as what you've just
outlined.  We need to see convincing proof.  Do you have any?"

There was an immediate buzz of agreement among the others.

"Excellent point," Yamamoto murmured.

Goth didn't reply immediately.  He removed his glasses and held them
toward the window, squinting at the thick lenses.  Then he wiped them
slowly with the bottom edge of his lab coat.

"Well?"  Stewart demanded.

Goth hooked his glasses back around his ears.  "I see the point, of
course," he admitted.  "I confess I don't know much about financial
matters.  The intricacies of business are as much a mystery to me as I
assume the world of microbiology is to all of you.  But this much I
know.  Even the most cautious venture capitalist realizes that there is
no such thing as a risk-free investment.  If I could show you
proof--ideally in the form of a real child demonstrating the abilities
my genetic program will make possible--then I would hardly need your
money to complete my research.  I could set up my clinic tomorrow and
start making it myself.  I could even franchise the procedure--set up a
string of clinics around the world.  I could set up my own biogenetics
company and sell stock in it.  Let's face it, gentlemen.  I could get
rich overnight."

"Suppose one of us was willing to put up the money," Yamamoto said.

"What share of the eventual profits would you offer?"

"Half," Goth replied.  "Fifty percent, minus operating expenses, to be
shared equally."

"Not enough," Baroness von Hauser interjected.

"Why not?"  Goth shot back.  He appeared stunned.  Stewart smiled.

Goth obviously thought his fifty-percent offer was more than
magnammous.

"You haven't thought it through," the baroness informed him.

"When you finish your research, the money isn't just going to start
rolling in.  There'll be substantial development costs.  Setting up
clinics, for example.  Hiring qualified doctors and training
biotechnicians.  Who's going to pay for all of that?  Obviously it'll
have to be your backers."

Goth frowned.  "Well, what do you consider fair?"

The baroness scratched her bare knee as she thought about it.

Stewart watched the lazy movement of her red-painted fingernails along
the tanned surface of flesh and felt a warm tingling sensation in his
groin.

"Ninety percent," she said.

Goth's face turned from its pasty white to a mottled purple.

Stewart chuckled.  The baroness was beginning to show a little of the
steel under her luxurious exterior.

"I could never agree to anything like that," Goth protested, when he
had found his tongue again.  "That's not profit sharing --that's
exploitation."

The baroness made no effort to defend her offer.  She just shrugged and
flicked her fingers in a gesture of dismissal.

The room grew very still.  Stewart looked around.  No one else had any
questions.  They all appeared ready to leave.

"I'm amenable to discuss percentages," Goth said, attempting to
resuscitate the discussion.  "I'm not interested in personal
enrichment.  I just want to get on with my work.  You must understand
that.  My work is everything to me.  Please think about what I've
said.

My discoveries are real.  Jupiter is real.  If any of you wish to
pursue this further, you can find me in my lab."

With a tight-lipped grimace of defeat Goth picked up the catalogue he
had shown them earlier and prepared to depart.  "If I don't hear from
any of you in a couple of days, I'll seek help elsewhere."

Harry Fairfield raised a hand.  A mischievous grin lit his ruddy
face.

"I have another question, Doctor."

Goth glared at Fairfield with obvious distaste.  "What is it?"

"Can this Jupiter program of yours do anything about cock size?"

Everyone laughed except Harold Goth.  He jammed the catalogue under his
arm and stormed out of the room, the veins in his forehead pulsing with
fury.

Anne Stewart walked unsteadily across the mansion's dimly lit entrance
hall to the enormous winding staircase.  She grabbed the banister
railing as if it were a lifeline, and hauled herself up the
interminably long flight of stairs, consciously placing each foot as
she went.

How she hated this house--so large and cold and intimidating.

Nothing in it had anything to do with her.  Not one piece of rare
antique furniture, not one bit of hand-painted wallpaper or linen
drapery.  Not one painting or mirror or candlestick holder.  Not even
the piano.  It had all been here when she arrived, and would probably
all be here when she left.  Most of the rooms never saw anyone for
weeks at a time, save an occasional domestic with a vacuum cleaner and
a dust rag.  It didn't feel like home at all.  It felt like an
institution.  It reminded her of one of those mansions that had once
belonged to some long-dead famous person and were now open for public
tours.  All it lacked were the brass stands with velvet-covered ropes
and a few signs admonishing visitors not to touch anything.  How was
she ever going to go on living here?

She reached the safe harbor of her bedroom at the end of the
second-story hallway.  Once inside, she locked the door behind her and
collapsed onto the bed.

The damned committee meeting.  She had missed it.  She considered
calling Mrs. Talley to apologize and make some lame excuse, but she
didn't trust her tongue to get the words out.

51

Instead, she called down to the kitchen and mumbled something to
Amelia, the cook, about not feeling well.  She intended to retire
early, without dinner.

As soon as she lay back against the pillow, the ceiling over her head
began revolving slowly.  She closed her eyes, and the bed began to
roll.  She opened her eyes.  The ceiling was still spinning.

My God, she thought, five o'clock on a Monday afternoon and she was
drunk.  Oh, Lexy, why did you do this to me A tide of nausea surged
toward her throat.  Clutching the bedpost to steady herself, she swung
her legs over the side of the bed and sat up.  Praying that the floor
wouldn't tilt beneath her, she got to her feet and lunged toward the
bathroom, hands cupped over her mouth.

She reached the toilet on her knees, groped blindly for the sides, and
retched noisily into it.

After a few minutes she felt marginally restored, but she was reluctant
to move.  The cold porcelain lip of the bowl felt good against her
forehead.  Without looking, she reached up and tripped the flush
mechanism.

She wished that she were back home in Vermont.

Home.  Something she had never really known.  The closest she had ever
come was a run-down three-room rental in a destitute mill town out in a
depopulated wilderness called the Northeast Kingdom.  And she never
really wanted to go back there.

Georges and Marie-Claire Beauregard.  French Catholic and poor.  And
both dead now.  She had loved them, she supposed, even though they
weren't her real parents.

She didn't know her real parents.  The state's Department of Social
Welfare had taken her from them when she was three years old.  Barely
more than children themselves, they had neglected Anne so completely
that the welfare officials feared she might starve to death.  Or so
Mama Marie had told her when she was growing up.

Nothing about her natural parents remained in Anne's conscious
memory.

Even their names were absent.  Anne's life did not really begin until
the age of seven, when Georges and MarieClaire rescued her from a
series of foster homes.  A childless middle-aged couple from the
province of Quebec, they adopted her, and she became Anne Marie
Beauregard.

They did the best they could, but Anne's life was bleak.  Georges died
when Anne was eleven, and Marie-Claire, fragile and superstitious even
when Georges was alive, simply couldn't cope with his death.  She
stopped cooking, stopped cleaning, stopped getting dressed.  She waited
out the rest of her life in bed, in front of a TV set.  Anne, not yet a
teenager, was forced to take over the household herself.  She did the
shopping and the cleaning and the cooking.  Georges had left no
money.

They lived on welfare and a minuscule retirement pension from Georges's
years with the Canadian National Railways.

Anne rarely thought of those years--not because the memories were so
painful but because there was so little worth remembering.  They were a
blur of fatigue and drudgery, a bleak gray existence in a world in
which there was neither time nor money for dates or parties or even
decent clothes.

Keeping house, taking care of Marie-Claire, and going to school
consumed her days.  She came to hate that small TV set at the foot of
Mama Marie's bed.  It stayed on around the clock, blotting out real
life with an endless drone of soap operas, sitcoms, cop and detective
dramas, quiz shows, talk shows, and commercials.

It still disturbed Anne to be in a room with a TV set turned on.

She found her escape in books.  If it had not been for the town
library, inadequately stocked as it was, her life would have been
impossibly grim.

In June 1989, five months before her seventeenth birthday, Anne
graduated from high school.  Anne had gone to the ceremonies by
herself, feeling miserable and alone amidst her happy classmates and
their families.  When she got home, she found Marie-Claire propped
against her pillows, her eyes staring vacantly at the TV screen.

Nearly an hour passed before Anne realized she was dead.

Anne pulled down the toilet seat and struggled to her feet.  She washed
out her mouth at the big marble sink and brushed her teeth.  She still
felt drunk, but at least the nausea had subsided and the floor was
holding steady.

Marie-Claire's death freed Anne.  She took a job in a local health
clinic, and when she had saved a little money, she enrolled at a nearby
two-year community college.  She did so well there that she was able to
transfer to the University of Vermont on a scholarship.  At the
university she blossomed.  She chose biology as her major, and she
excelled at it, much to the surprise of the male-chauvinist head of the
department.  Even with the scholarship, she still had to work part-time
as a receptionist at a medical center to support herself, but for the
first time she began having a social life.  Her astonishing good looks,
hidden from the world during her high school years, were hidden no
longer.  Male students followed her around like a permanent band of
courtiers, constantly vying with each other for her attention.

She lost her virginity to her piano teacher, a handsome, charming
professor in the school's music department.  He threatened to kill
himself if she didn't consent to marry him.  She agreed reluctantly,
but was able to back out at the last minute when he confessed that he
ad been married twice before and had five children.

She graduated from the university with honors and went to work at a
biological supply house in her hometown, Burlington, Vermont.  After
two years there she had made up her mind to go back to college for an
advanced degree.  She had decided to pursue a career in biology,
probably as a teacher.

But that decision got canceled.

One day Dalton Stewart walked into her lab, flanked by his
chauffeur-bodyguard and a couple of assistants.  He was looking for the
head of the accounting department.  It seemed that he had just bought
the company, and he wanted to see the firm's financial records.

He was tall and charming in a worldly way that impressed Anne
enormously.  He was also very rich--the ultimate eligible bachelor.

People magazine had recently run a story on him, detailing his
high-powered business and social life.  He had dated many celebrities,
and there were always rumors flying in the gossip columns about whom he
might marry next.

On his way out of the building, he returned to the lab and Jupiter's
laugter ù 55 handed Anne a note that sent her pulse hammering: "You're
an extraordinarily beautiful woman.  Will you have dinner with me
tonight?  I'm staying at the Ethan Allen Hotel.  Please call me
there."

Anne didn't call him.  She had a date with her boyfriend, Matty, and
she had no intention of breaking it, even for Dalton Stewart.

The idea of going out with him terrified her, anyway.  He was divorced,
nearly twice her age, and impossibly glamorous.  And she was put off by
the implicit assumption in his note: that she'd come running just
because he was who he was.

To her astonishment, he reappeared in the lab the next day and asked
her to dinner again.  She blushed and stuttered, but turned him down.

This time she lied and told him she already had plans for the
evening.

He persisted, and finally got her to agree to see him the following
Friday.  He was supposed to be at a business conference in Barcelona,
but he said he'd change his plans just to see her.

Her friends in the lab, meanwhile, were going quietly berserk.

They couldn't believe that she had had the nerve to give him such a
hard time.  She should jump at the chance to go out with him, they
insisted.  Anne wasn't so sure.  She couldn't understand why someone
like Stewart should show any interest in her in the first place.  They
couldn't possibly have anything in common.  The day before their Friday
date, she called his office in New York and canceled.

Anne removed her dress and her underclothes and stepped into the
shower.  She turned the water on as cold as she could stand it, let it
run for a few minutes, then mixed in the hot until the spray felt warm
and soothing.  She stood under it for a long time, until she was aware
of nothing but the pleasant sensation of the water beating down on her
shoulders and back.

Dalton Stewart had refused to give up.  The more she resisted him, it
seemed, the harder he tried.  Finally, in the mistaken belief that the
only way to discourage him was to go out with him and get it over with,
she agreed to a date.

And some date it turned out to be.

Stewart suggested they start early and do a little sightseeing.

At five P.M. his chauffeur drove them to the Burlington airport.

They boarded his private jet and circled over Lake Champlain.

Anne was delighted.  She pointed out some of the landmarks of the city
of Burlington below.

"Have you ever seen the Eiffel Tower?"  Stewart asked.

Anne laughed.  "In Paris?  No.  Someday, though."

"How about right now?"

"Right now?  What?"

"Let's go see the Eiffel Tower."

The twin-engine Lear altered course to the east, climbed to thirty
thousand feet, and flew to France.  They talked through the evening and
had dinner on the plane.  After seven hours, just as dawn was breaking
across Paris, Anne looked down and saw Sacre-Coeur, Notre-Dame, the Arc
de Triomphe, and, of course, the Eiffel Tower.  The magic of the moment
moved her to tears.

Through some friend in the French foreign ministry Stewart arranged for
customs at Orly Airport to admit Anne into the country without a
passport, and they had breakfast at a lively cafe on the Left Bank.

After that they spent the day shopping and touring the city in a
limousine.  He had rented a double suite for them at the Hotel Meurice
on the rue de Rivoli.  Their windows looked out over the Tuileries and
the Louvre.

Anne had dreamed for a long time of seeing Paris.  Now there it was,
right outside her window.  She felt giddy, euphoric.  In her entire
life she had never been any further from Burlington, Vermont, than
Boston, Massachusetts.

They had dinner at L'Hotel with a famous French actress and her
producer husband.  Anne charmed them with her provincial Canadian
French, and the producer offered her a part in his next movie.

Everyone drank a lot of wine, and the mood was festive.

At one point Dalton leaned close and whispered in her ear.

"Can I ask you an important question?"

Anne shook her head playfully.  "No.  Only silly questions are allowed
today."

"Okay.  A silly question then.  Will you marry me?"

Anne felt her heart flip.  "That is a silly question," she replied.

Later, at the Brasserie Lipp, they sat at a crowded table with

!

more famous people--many of them acquaintances of Dalton's --and drank
more wine.  There was a well-known American TV journalist and his
writer wife, and so many others who came and went during the evening
that she lost track.  During the quieter moments, Dalton continued to
press his case for marriage, painting a stirring picture of what a
wonderful life they would have together.  She protested.  They barely
knew one another, after all.

On their way back to the Hotel Meurice at three in the morning, Anne,
sleep-starved and bleary with jet lag, said she'd at least have to have
some time to think about it.  In the elevator up to their suite she
said yes, she probably would marry him.  Dalton completed his whirlwind
seduction that night in bed.  Anne succumbed almost with relief.

The best surprise was how exciting the sex was.  In retrospect, much of
it had to do with the circumstances--the wine, the sense of
dislocation, the removal from everything familiar--which let her
surrender so completely to the sensual side of her nature.  She had had
sex with four other men--the music professor, Matty, one previous
boyfriend, and another professor, who had forced himself on her in his
office.  None of them had given her pleasure like this.  If she wasn't
yet in love, she decided, it was certainly a great beginning.

A month later, Anne Marie Beauregard and Dalton Francis Stewart III
were married at a small private ceremony on Long Island.  Dalton
apologized for insisting that everything be done so quickly, but there
were so many demands on his time, he felt that if they didn't get
married now, the opportunity might be lost forever.

After a short honeymoon in the Caribbean, Dalton parked Anne in his
estate on Long Island and went on with his life as before.  She rarely
saw him anymore.  The last time had been a week ago.  He was just back
from somewhere and on his way to somewhere else.  They had dinner and
spent the night at the family's brownstone on Fifth Avenue.  The next
morning he was gone.

The sex that night had been rushed and perfunctory.  Dalton brought her
some gifts and asked her if there was anything she needed.  Otherwise,
he was his usual distant, distracted self.

Thinking back on that incredible courtship, Anne now saw it in a new
light.  Dalton had approached their relationship as if it were a
contest and she were the prize.  Once he decided he wanted her, he had
gone after her, pulling out all the stops.  And her early resistance
had only increased his determination.  He wouldn't quit until he had
subdued her.

She had consented, she realized with some mortification, just because
it was so much a part of her nature to be agreeable.  He had bulldozed
her, and she had been too polite and intimidated to resist, or to
insist on a larger say in matters.  She hadn't negotiated with him.

She had surrendered to him.  And now that he had the prize, his
interest in her had faded.  Professions of love notwithstanding, he
didn't seem to want a real relationship.  He didn't seem to care who
she was or what she wanted out of life.

She had tried to persuade Dalton to let her take a job in
Manhattan--she had been offered a research position at the Rockefeller
Institute that she very much wanted to take--but he had talked her out
of it.  He told her that her social status made any job, especially a
career, out of the question.  While he succeeded in the world of
business, he expected her to succeed for them in the world of
society.

It wasn't enough to be rich, he insisted; one also had to know the
right people, do the right things, be seen at the right places.  It was
up to her to see to these matters.  That was to be her career.

She had tried, but she had little feeling for society and its demands,
and no desire to rise in it.  It was all painfully boring and phony.

And then there was the matter of children.  She had told him before
they were married how much she wanted children--how important a family
was to her.  He had agreed enthusiastically.  It was important to him
also.

But he had insisted from the very beginning that she use birth
control.

One night, after a particularly torrid bout of lovemaking, he asked her
if she was remembering her pills.

"What if I said no?"  she asked teasingly.

"I'd be upset," he replied.

Jup1tens L)augnter ù

"Why?  I thought we were going to have children.  Why wait?

I'm ready now."

"No, you can't," Dalton replied, his voice suddenly tight.

"I can't?  Why not?"

Dalton remained silent.

"You're frightening me, Dalton," she said.  "Talk to me.  Why can't
I?"

Dalton sat up in bed.  "I've got a problem," he whispered.  "A bad
gene.  It can be inherited.  It causes severe retardation."

Anne could scarcely believe his words.  She felt as if he had punched
her in the stomach.  "Why didn't you tell me?"  she demanded.  "You
owed it to me to tell me."

Dalton hid his face in his hands.  "I know.  I know.  I wanted to.

Believe me.  But I was afraid you'd back out of the marriage.

I didn't want to risk losing you.  I'm sorry, Anne.  Honest, I am
sorry."

Anne felt cruelly deceived nevertheless.  Life without children would
be unthinkably empty.  The following day Dalton made a lot of apologies
and excuses and vaguely promised that if there was no other solution,
they would adopt.

Anne stepped out of the shower and dried herself.  She felt slightly
better.  She stood in front of the full-length mirror on the bathroom
wall and studied herself in the bright light of the ceiling heat
lamps.

Was she really beautiful?  People always said she was, but she didn't
quite believe it.  She thought of herself as very average.

Maybe that's all beauty was--being quintessentially average.  At the
moment she looked more bedraggled than beautiful.

She wrapped a towel around her waist and walked back into the
bedroom.

She shook her head.  It hurt.  She was still drunk.

She closed the drapes to shut out the late-afternoon light, then flung
herself nude on top of the bed.  The room felt hot, stuffy.

Her eyes wandered to the ornate molded plaster border that defined the
edges of the bedroom ceiling.  The corners were the fanciest--a
delicate scrollwork of leaf clusters and other design elements she
could not identify.  Suddenly she spotted a small face, a chimera,
hiding among the leaves.  It appeared to be leering down at her.  She
squinted her eyes, but the face remained.  Silly.

An illusion caused by the room's dim light, she decided.  If she opened
the drapes or turned on a lamp, she knew, the face would disappear.

She kept her eyes fastened on the small face until she began to feel
dizzy again.

She rested a hand on her breast and brought her other hand up between
her legs.  She closed her eyes and squeezed her thighs against her
fingers.  Through the haze of the wine, she felt a warm rush of
desire.

She squeezed her legs together harder and dug her fingers into her
breast.

Tears welled from the corners of her eyes.  Why did she have to spend
her life feeling lonely and unloved?

6

Dalton Stewart came out of Goth's lab and walked straight to his rented
Toyota Land Cruiser, parked just outside the building.

Waiting for him were his chief executive assistant, Hank Ajemian, and
his chauffeur-bodyguard, Gil Trabert.  Ajemian opened the back door for
his boss and then slid in beside him.

Stewart removed the gold fountain pen clipped to his shirt pocket and
held it out.  A miniature microphone and transmitter were concealed
inside.  Goth had refused to allow any recording devices inside his
office, so Stewart had resorted to using a bug with a remote
transmitter.  "Did you get everything?"  he asked.

Ajemian picked up the portable laser-disk recorder from the floor and
set it on his lap.  "Came through perfectly."

Trabert started the jeep and wheeled it slowly out of the weedchoked
lot.  Prince Bandar's jeep was already bouncing down the hill, trailing
a cloud of dust.  Yamamoto and Fairfield, who had come out behind
Stewart, were just getting into their vehicles.

Stewart craned his neck around to look back toward the lab's
entrance.

He was wondering what had become of the baroness.

He had hoped to speak to her, but she was nowhere in sight.

Stewart looked at his chief assistant, slumped forward in his wrinkled
suit.  Ajemian was short, overweight, and bald.  He suffered from
allergies that caused dark circles under his eyes and gave his Brooklyn
accent an added overtone of nasal congestion.

He presented a dramatic contrast to his tall, slim, well-manicured WASP
boss.

"You heard it all," Stewart said.  "What did you think?"

Ajemian closed his eyes and sniffled.  Some plant pollen in the air was
making his nose run and his eyes water.  "Goth sounds a little off the
wall to me," he ventured.

"You think so?"

"Well, you asked the key question," Ajemian answered, instinctively
flattering his boss.  "Where's the proof?  He said he doesn't have any,
so what the hell is he talking about?"

"You think he's a fraud?"

"I don't rule it out.  More likely Goth is conning himself.  He wants
to believe he can do these things.  Maybe he needs to believe it."

"You think we should forget it, then?"

Ajemian pulled a tissue from his pocket and blew his nose loudly.  He
hated it when his boss put him on the spot like this.

"Well, what's he offering us?  Basically nothing--beyond his word.  And
I don't think that's worth much.  As you yourself said--" "Stop quoting
me, for godsakes.  I know what I said."

Ajemian nodded.

"I want to think about it," Stewart decided.

Both men were clutching the edges of the seats in front of them to keep
from being thrown around by the rough mountain road.

Stewart appraised his chief assistant.  He was wearing that hangdog
look he put on whenever Stewart was abrupt with him.

He paid Hank Ajemian a million dollars a year, along with stock
options, a fat expense account, and a complete medical plan.  And
Ajemian was worth it.  He didn't have much imagination, but he was
quick and savvy, and an absolute wizard with a balance sheet.  He could
cut corners and bend rules with the best of them.  He knew how to pull
out all the stops to outwit a rival in a deal or to confound and defeat
an army of regulatory investigators.  He could put together--or take
apart--a deal like no one else Stewart had ever known.  When Ajemian
was doing the numbers, the competition didn't stand a chance.

And Stewart trusted him.  He was loyal.  And it wasn't just his
personality that made him that way.  He owed Stewart a lot.

In 1988 Ajemian had been hit by both the SEC and the United States
Attorney General's office in a Wall Street securities fraud case that
sent him to the federal penitentiary in Danbury, Connecticut, for three
years.  When he got out of prison, in 1992, no one would hire him.  He
had a wife and three children, and he was reduced to sending his kids
to live with relatives while he and his wife, Carol, cleaned offices to
stay alive.

That was how he met Dalton Stewart.  He was polishing his office floor
one night when Stewart walked in.  Ajemian had seen some papers on
Stewart's desk relating to plans to buy out a small pharmaceuticals
company in upstate New York.  He couldn't resist pointing out a few
ways in which Stewart might improve his bargaining position.  Stewart,
once he got over the shock of being given advice by a nosy cleaning
man, was impressed.  Despite Ajemian's jail record, he put him on the
payroll as an investment consultant.  Stewart had reason to be
sympathetic.  His own father had once gone to prison for a crime
similar to Ajemian's.

In the years since, Ajemian had become Stewart's only real confidant.

"Goth's a crackpot," Ajemian declared.  "You read the file.  He's an
embarrassment in the scientific community."

"He won the Nobel Prize."

"He's still a crackpot."

"Hold on a minute," Stewart countered.  "Don't confuse being
controversial with being crazy.  The guy's a genius.  Nobody disputes
that.  And I find it hard to believe that a man with his brains--and
ego--would spend ten years working a dry hole.

He's on to something.  And if he can do what he says he can do .  .

."

Stewart paused.  He felt a sudden euphoric rush, akin to the sensation
he experienced when he decided to go after a beautiful woman.  "There's
an opportunity to make some money here, Hank.  A lot of money."

Ajemian rubbed his nose.  "Goth may be years from being able to produce
the kind of genetic package he was talking about in there."

"That's part of the risk of backing him.  But he's not asking for much,
either.  Ten million.  That's not big money.  We lost twice that last
year on that damned drugstore chain you talked me into buying."

"It was only twelve million," Ajemian protested.  "And the numbers were
there--" Stewart waved a hand to cut him off.  "Think of the
possibilities.  If the genetic program works even half as well as Goth
says it will, the market for it is unlimited.  We're talking about the
one thing that matters to people more than anything else in their life
--their children.  Everybody naturally wants the best.  And a kid who's
a genius?  Who never gets sick?  Who'll probably live to be over a
hundred?  My God, they'll be kicking the doors down.

Everybody will want this.  Those who can afford it will demand to have
it."

The jeep reached the bottom of the mountain road, and Trabert swung it
onto the highway and headed back toward their hotel on the west end of
the island.

"If it works," Ajemian said.  He pulled out another tissue to wipe his
nose.

Stewart warmed to his subject.  "We could build the first clinic right
here.  Just buy up that medical school up on the hill.  It's perfect.

Give Goth whatever he needs and put him in charge.  Then buy up one of
the island's best hotels.  Or build one.  Or two.

People who come to the clinic could make it a Caribbean vacation.  And
we'd sock it to them.  Make the deal so expensive only the rich could
afford it.  Hell, we could set almost any price we wanted.  Figure a
package deal of about a hundred thousand dollars per couple, everything
included--food, transportation, hotel, and all the time they need at
the clinic.  Probably a week, with some future trips during and after
the pregnancy.  We might charge more for those.  When the first clinic
is going full blast, we build a second one.  And another hotel.  And
then a third.  When the island can't hold any more, we find a second
island.  And right now the whole region's economy is a shambles.  We
could buy up beach front property for nothing on half a dozen
out-of-the-way islands.  Then invite some of the big, prestigious
chains--Hyatt, Sheraton--to build here.  And while we're at it, we'll
buy out one

Jupiter s Laugter ù 65

of the local feeder airlines and expand it.  Maybe we could even
develop our own international routes....

Ajemian tucked the used tissue into his pants pocket.  "What about
legal problems?"

"I don't think there are any.  In fact, the legal situation could work
to our benefit.  If genetic research on the germ line is illegal
everywhere else, then people'll have no choice except to come down
here.  We'd have the whole market to ourselves--indefinitely.  Even if
someone stole the program, he'd be hard put to find a place to set up
the sophisticated clinics needed to administer it.  Of course we'd have
to protect ourselves--keep the local politicians here happy.  That
shouldn't be hard.  We can make the economy on this island boom."

Ajemian still resisted the idea.  "What about Goth himself?  He could
be a problem.  I heard him asking for fifty percent in there."

"I've been thinking about that.  Fifty percent is out of the question,
of course.  Even a thirty-percent share's too high.  But suppose we
just offer him carte blanche.  Go to him and say, 'Look, here's the ten
million.  It's a grant.  No strings attached.  Just get to work.

When you've got your formula in shape, then we'll sit down and work out
a long-term arrangement."  Nobody can possibly offer him a better deal
than that."

Ajemian sniffled.  "No, but what's to keep him from taking his formula
to the highest bidden-after weJve paid him to develop it?"

"Let him think he can do just that.  He's arrogant enough to think he
deserves it.  And naive enough about business to go for it.  But by the
time he's spent our ten million, we'll own him.  He'll have to get our
permission to go to the bathroom.  For openers, we'll buy the medical
school and make ourselves his landlord.

And we'll make sure that we have a copy of that genetic program of his
physically in our possession before he can do anything with it.  Then
he'll have to accept whatever we put on the table."

Ajemian saw that his boss was not going to be dissuaded.  He shifted
his ground to tactical considerations.  "What about the others at the
meeting today?  We could have competition."

"I wonder.  You can count Harry Fairfield out, for one.  He's
aggressive, but he's no good at development.  He's after the quick
buck.  His attitude gave him away.  He didn't take Goth seriously.

And he's also in trouble with the British government."

"Tax evasion.  That's nothing to Fairfield."

"Not that.  Rumors are going around that he's been selling bad drugs
through a generic-brand subsidiary.  Scotland Yard is going to whack
him hard.  He'll be too distracted to get involved with Goth's
program.

Prince Bandar is out, too.  He was too lazy to bother to do his
homework.  He didn't ask a single question during Goth's
presentation.

I think he was half-asleep."

"Yamamoto?"

"Hard to tell.  He has big government connections.  I can see him
trying to buy Goth out.  And if that doesn't work--which it won't--he
might try to steal the program.  The Japs would rather develop
something like this on their own."

Ajemian nodded in agreement.  "And I guess the baroness is out."

Stewart stroked his chin.  "I don't know.  She may be the one to worry
about."

"I thought she pretty much told Goth no during the meeting."

"The baroness is clever.  I've got a hunch that's the way she wanted it
to look.  But what did she actually say?  She told Goth she'd demand
ninety percent, not fifty.  So she's already negotiating with him.  And
she knows as much about genetic research as any of us."

"Then she's trouble.  Beneath that glamorous exterior of hers there's
one tough bitch, no matter what you read in the magazines."

"Hell, we'll beat her pants off," Stewart said.  He grinned.

"Figuratively speaking, of course."

Ajemian wasn't convinced.  "It just feels wrong to me."

Dalton laughed.  "What kind of argument is that?"  He banged the top of
the seat back in front of him.  "Come on, let's go for it."

Ajemian just grunted.

"As soon as we get back to the hotel I want you to do the

JUIzr LJuurz u/

following," Stewart said.  "Find out who owns the medical school, and
buy the whole thing, cash.  They ought to be eager to unload it,
considering the shape it's in.  Get a binder on the property.  Fly in a
couple of our lawyers if you have to.  Set up a shell company as
owner.

Then set me up with a date to see President Despres, ASAP.  We've got
to get his balls in our pocket right away."

"Should I scout out some beach front properties as well?"

"That can wait.  Let's not tip our hand.  But call New York and put R&D
on notice that when I get back I want to see on my desk a complete
profile of this island--voting lists, tax lists, realestate ownership,
phone numbers, arrest records, gossip, everything they can lay their
hands on.  Then I want three detailed biographies--Harold Goth,
Yuichiro Yamamoto, and Baroness Gerta von Hauser.  Everything there is
to know about them--their work, personal habits, friends, enemies, sex
life, financial status, health, eating habits--the works.  I want them
fast.  Put the whole department on them full-time."

Ajemian scribbled some notes to himself, then looked up.

"What about this afternoon?  You're scheduled to fly to Puerto Rico to
look at that new chemical plant."

"Cancel it.  I'm going back to make Goth an offer.  I've just thought
of a way to find out if this Jupiter program of his is the real
thing."

Dalton Stewart found Dr. Harold Goth in his laboratory, hunched over a
computer terminal.  On a stand nearby, an old dot-matrix printer was
cranking out a continuous strip of fanfold paper that spilled to the
floor in an erratic, untended pile.  The pages were covered with charts
and diagrams.

Stewart was surprised that Goth was so careless of his security; he had
walked right into the building and the lab unannounced and unseen.  He
was now standing ten feet behind Goth, and the doctor, riveted to his
computer screen, was still oblivious of his presence.  Kirsten, his
research assistant, sat on a stool in the far corner, peering into a
microscope.  She had not noticed his entrance, either.  Stewart cleared
his throat loudly.

Goth glanced over his shoulder.  He greeted Stewart bluntly: "What do
you want?"

"I want you to succeed, Doctor," Stewart said, inflecting the words
with all the warmth he could muster.

Goth dismissed him with a short wave of his hand.  "If you're here to
make me an offer, you're too late."

Stewart's genial grin vanished.  "Too late?"

"The Baroness von Hauser has already made a proposal."

Stewart felt his pulse quicken.  "Surely you haven't accepted it --have
you?"

Goth shrugged.  "It's adequate."

"But you haven't heard my offer yet."

"I don't want to."

68

"Don't be hasty, Doctor.  I have a plan I think you'll find far more
attractive."

Goth was clearly eager to get rid of him.  "I really don't need a lot
of money," he snapped.

"I understand.  But there are other considerations, aren't there ?  "
Goth's eyebrows narrowed in a suspicious squint.  "What do you mean?"

"What are the baroness's terms?"

Goth hesitated for a moment.  "She's accepted sixty percent," he said,
finally.

Stewart nodded.  Obviously the doctor thought he had driven a hell of a
bargain, getting her down from her pretended insistence on ninety
percent.  "How much capital is she prepared to advance to you?"

"Exactly what I demanded.  Ten million dollars."

"How will she pay it out?"

"Spread over two years."

"And you're happy with that?"

"I can live with it."

"No other conditions?"

"Some oversight," Goth muttered.  He wasn't crazy about that part of
the bargain.

Stewart rested his hands on the counter top behind him and leaned back,
calculating how he might best deliver the baroness a figurative kick
right in her smart, round ass.

"That could be trouble, couldn't it?"  he said.  "I could be wrong, but
oversight's likely to mean Hauser lawyers and CPAs constantly hounding
you to account for every dollar.  It could even mean Hauser biologists
sticking their noses in your laboratory work.  I understand the
baroness has a reputation for meddling.

She likes to be personally involved in her projects.  Ask anybody who's
dealt with her.  They'll tell you the same.  It could slow you down."

Goth slid a thumb and forefinger up under his glasses and squeezed the
bridge of his nose thoughtfully.  Bull's-eye, Stewart thought.

"I have to be a realist," Goth replied.  "I don't expect anything
better."

"Why shouldn't you?"

Goth chewed his lip.  His skepticism was warring with his curiosity.

"What are you talking about?"

"A better offer.  I'll advance you all the money you require.

Forget ten million--I'll go to twenty.  And you can have the money when
and as you need it.  And you won't have to account for a nickel of it
to anybody.  How you spend it will be entirely up to you."

"And what percentage of Jupiter would you expect?"

"At this stage, absolutely none.  There'd be no conditions attached to
the money--none whatsoever.  Consider it a research grant.  Period.

When you're ready to market Jupiter, we'll discuss percentages then.

If we can't come to terms, you'll be free to take the project
elsewhere.  If you fail to develop a workable program, then percentages
won't matter anyway."

Goth stared at Stewart disbelievingly; he was not a man accustomed to
good news.  "What's the catch?"

"There isn't any.  I said no strings--I mean it.  I respect your
work.

And I believe you can do what you say you can do.  If I can help you,
then we'll all be winners.  To try to tie you down to an agreement now
is neither necessary nor advisable, in my view.  Look at it this way:
if things go better for you than you expect, you might end up feeling I
took advantage of you when you weren't in a strong negotiating
position.  That's exactly what the baroness is doing now.  I want any
arrangement between us to be completely fair.  I want to lay the
groundwork for an enduring association."

"And what about your twenty million?  You'll no doubt expect that money
back--with interest."

"Not at all.  It'll be a tax loss.  I'll set up a foundation
specifically for this project, so that I can declare the sums
charitable contributions."

Goth removed his glasses and wiped them with the bottom of his lab
jacket.  Stewart saw that he was wavering.

"I'm a rich man, Dr. Goth," Stewart said, reaching to clinch his
argument.  "I don't need to be any richer.  The twenty million dollars
is, quite frankly, not a lot of money to me.  And even if it were, I've
reached the stage in my life and career where the social worth of a
venture matters far more to me than its potential profits.  I can
understand why you might have doubts, but bear in mind that what I'm
proposing doesn't even demand any trust on your part.  I simply give
you the money you need, and you do what you have to do.  Nobody'll be
looking over your shoulder.

No lawyers, no accountants, no scientific committees.  I have
absolutely no need to take advantage of you.  The tax break I'll get is
lone worth the investment.  I won't lose out, no matter what happens.

It's a perfect arrangement for both of us.  All you need to agree to on
paper is that you won't seek funding elsewhere-or enter into any legal
contracts with anybody before I've had a chance to negotiate with you
first."

"I'll have to think it over," Goth said.

"Of course.  How long do you need?"

"A couple of days."

Stewart shook his head emphatically.  "I appreciate that you're a
shrewd bargainer, Doctor," he said.  "But I can't let you shop my offer
around.  That'd be unfair to me.  I tell you what.  I'll leave the
offer on the table for one hour.  That should give you adequate time to
decide.  Then it's take it or leave it, I'm afraid."

Goth paced the floor.  He asked Stewart to repeat his terms again.

Then he asked a lot of unimportant questions: how soon he could get the
money, and what bank he would use, and who would know about their
arrangement, and so on.  Stewart knew at that point that Goth had
already accepted his offer.  He just didn't want to appear too eager.

The doctor obviously thought of himself as someone who could never be
seduced into compromising his ideals.  And like most loners, he
insisted on calling all the shots and doing all the work himself,
because no one else could be trusted to do it right.  He thought that
this made him invulnerable, when in fact it was his major weakness.  He
thought that because he was a genius in the field of genetics, that
made him a genius in other areas as well.  If Goth had known anything
about business at all, Stewart reflected, he would have known that in a
matter as important as this he needed expert legal advice.  But Goth
didn't think that.

"Okay," Goth said.  "But if you try to impose conditions after the
fact, the deal is off."

"Understood."  Stewart held out his hand.  Goth hesitated, then took
it.  He had a lousy handshake.

"Since I'm taking all the risks, I do have a few questions I want to
ask you, Doctor."

Goth looked mildly alarmed.  "What are they?"

"First, I thought you were a little evasive earlier today when I asked
you if you had ever tested Jupiter on a human subject.  I find it hard
to believe that you never have.  So let me ask the question again."

Instead of answering the question, Goth excused himself and walked to
the far end of the lab, where his assistant was still perched on her
stool.  She had barely stirred the whole time he was there.  Goth
ordered her to go find something for him.  She objected briefly, then
left the room.

"Can I trust you to keep something completely confidential?"  the
doctor asked, walking back toward Stewart.

"Of course.  Absolutely."

"Very well .  . ."  Goth paused.  A look of intense discomfort-almost
pain--creased his face.  "Two years ago forty women from the island
volunteered for an in vitro fertilization program...."

Stewart felt his scalp tingle with dread.  "And .  . . ?"

"None of the fetuses survived," Goth said, looking off into the middle
distance.

"What was the problem?"

Goth waved a hand.  "It's futile to try to explain it to a layman.

Suffice it to say there was an unexpected anomaly in an altered gene
sequence on chromosome 4, causing it to suppress the manufacture of a
certain critical protein.  Normally such an event wouldn't cause
problems; anomalies of this kind are common and usually harmless.  But
in this case we were exceptionally unlucky.

Slight as it was, the mistake made all the fetuses nonviable.  It was
impossible to know this would happen until we conducted just

Jupler s Laugnler ù /

such a trial.  None of the women suffered any ill effects.  And of
course I have since solved the problem."

"And have you tested your solution?"

"As soon as I have the necessary funding, I will.  That's my first
priority."

Stewart thought for a moment.  "There could be other problems, then,
couldn't there?"

Goth straightened his bony chest and tilted his head back.  He didn't
like having his competence challenged.  "There can always be problems,
Mr. Stewart.  The human genome is a dynamic entity, in constant
flux.

No one will ever be able to ensure perfect results in every instance.

There will always be the unexpected."

"I was thinking in more immediate terms.  How close do you think you
are to having a workable program?"

"I have it now.  But I can't rule out the possibility of more
problems.

That's exactly why I need additional time.  I must test the program
thoroughly.  This is a highly experimental area--immensely complex.  No
one else in the entire field of genetics is doing what I'm doing.  So I
have no support for my effort, no one to cross-check my results, no one
doing related research.  It's terra incognita, and I'm out there
alone.

There's a great deal I must do before I can be sure I haven't
overlooked anything."

"I understand," Stewart said.  Indeed, he thought the doctor was being
remarkably honest.  "I'm curious," he said.  "Why did you choose to do
this in the first place?"

"What do you mean?"

"You could have remained inside the scientific establishment.

Why didn't you?  Is the privilege of tinkering with human evolution
worth all the personal and professional sacrifices you've had to
make?"

Goth appeared astonished by the question.  "I don't see it in those
terms.  Whatever sacrifices I've had to make--and may still have to
make--I do in the name of a greater necessity."

Stewart was mystified.  "What necessity?"

Dr. Goth picked up a book from his desk, opened it to a page marked
with a slip of paper, and held it out for Stewart to see.

It contained a color illustration of a band of five prehistoric
males.

Their faces were painted and they were wearing animal skins.

They stood at what looked like the edge of a forest clearing.  Their
expressions were watchful, tense.  Each man clutched a stonetipped
spear.

"This is us," Goth said, tapping the illustration with a forefinger.

"Homo sapiens.  This is the way we looked about fifty thousand years
ago.  These men in the picture aren't hunting.  They're going into
battle against another group of Homo sapiens.  Maybe the others pose a
threat to this tribe's territory.  Or to their food supply.  Or to
their women.  Whatever the reason, they're getting ready for a fight to
the death."

Goth dropped the book back on the desk.  "Homo sapiens is the most
successful animal species ever to walk the earth," the doctor declared,
his words energized by a sudden display of enthusiasm for his
subject.

"He was ruthless and resourceful.  And uniquely gifted with a large
brain that allowed him to adapt to almost any circumstance.  And he did
adapt.  He multiplied and spread out.  He subdued his environment; he
eliminated every challenge to his superiority--until the only enemy
left was himself.  And despite centuries of ceaseless mutual human
slaughter, his success is still astonishing and undeniable.  He has
subdued the entire planet Earth.  He owns it."

Stewart raised a hand to slow the tide of words.  Inviting Goth to let
off some steam might help cement their relationship, but he didn't want
to hear an anthropology lecture.  "What's your point?  " "Simply
this.

We're those same primitive people today.  We have the same brain, the
same emotions, the same capabilities, the same shortcomings, the same
tolerances.  We haven't evolved at all.  In fact, as a species, we're
now in serious decline."

"And so .  . ."

"Don't you see?  We've become victims of our own success.

We've transformed the world to suit our needs, developed a technology
so powerful that there's almost nothing we can't do.  But we haven't
advanced to keep pace with our own creativity.  In fact, we've gone
backwards.  The improvements in our diet and

Juplrer s LJaugnzer ù /

our medicine and our technologies have only degraded our gene pool.

It's allowed the least fit among us to survive, multiply, and
contribute further to the decline of the species.  And meanwhile we go
on ransacking the earth's resources and polluting the earth's soil,
water, and air at an ever-increasing pace.  And unless we change our
habits, we're doomed.  The aggressive, adventurous exploring and
fighting instincts that got us here are no longer adequate to solve our
problems.  Normally the process of evolution would correct the
situation, would allow our species to adapt to our new
circumstances--raise our resistance to the pollutants in the air, to
the increased amount of radiation bombarding our skin, to the
increasingly crowded conditions of our lives.  But evolution is a slow
process.  It takes many generations of natural selection for
significant mutations to occur and succeed.  But we can't wait for
that.  We don't have the time.  In anthropological terms, Homo sapiens
has changed the world overnight.  Now we must change ourselves
overnight just to survive in the world we've created.  We have to take
the process of evolution into our own hands.  We have to step in and
take control of our destiny as a species."

Stewart was impressed.  Goth's little speech had breathtaking
implications.  And he might even be right.  "So the bottom line is that
either we rewrite our own genetic code or we're out of business?"

"That's essentially it, yes."

"And that's what your Jupiter program is designed to do?  Rewrite the
code?  Guarantee our survival?"

"Precisely."

Stewart shook his head dubiously.  "I'll have to confess, Doctor, from
what you told us earlier today your genetic changes just don't sound
that profound.  Or is there something you didn't tell us?"

Goth removed his glasses and polished the lenses with the bottom edge
of his lab jacket.  Stewart had seen him do it four or five times.  It
had become a neurotic tic.

"I told you the program would increase intelligence substantially,"
Goth replied.  "And that in itself--if it became wide spread--would
have a revolutionary impact.  If people were smarter, they'd be less
prone to settle their conflicts with violence.

They'd be more able to understand and solve the complex problems that
beset us today.  They'd understand where the true longterm interests of
mankind lay.  Consider population control.

They'd not only understand the necessity for it, they'd do something
about it.  Take war.  They'd see the futility of it.  Or the
destruction of the environment--they wouldn't tolerate it.  They
wouldn't tolerate a lot of things--murder, rape, torture, poverty,
hunger, bigotry, despotism...."

"What about your formula's enhancement of the senses?"

Stewart cut in.  "What's the point of that?"

"It'll increase an individual's survival value.  His perception of the
world around him will be widened.  And that perception will mean
greater knowledge and understanding."

"That might be more of an encumbrance than an advantage.

Won't it overload the human nervous system with a lot of unnecessary
additional noise?"

Goth shrugged.  "This program is only a beginning.  A prototype.  It'll
be refined and improved over time.  The important thing now is to get
started, before it's too late."

Stewart sensed that Goth was still keeping a lot to himself, but there
seemed no point in pressing him any further.  Jupiter, at this stage,
was still more theory than reality.

"It's an exciting adventure," Stewart said.  "I feel privileged to be
able to assist you in it."  This was the kind of flattery that rolled
from his tongue automatically when he was engaged in winning someone's
trust.  He heard himself say it and realized with a pleasant shock that
this time he actually meant it: it really was going to be an exciting
adventure.  It really could have profound social value.  And the
financial profits from it were going to be truly staggering.  "How long
do you think it'll be before you can test Jupiter on human subjects
again?"

"As soon as I can set up a clinic with the equipment and the personnel
I need for the gene alterations and the in vitro fertilization program,
I'll begin the tests.  It'll take several months."

Jupiter7s l)aughter ù 77

Stewart leaned closer and lowered his voice.  "Would you be willing to
test Jupiter right now?"

"I'm afraid I don't--" "On my wife."

Goth's eyes narrowed.

"That surprises you?"

"Why would you expose your wife to the risk?"

"You said you believed the program was ready."

"Yes, but I can't guarantee it'll work perfectly."

"I'm not asking you to," Stewart replied.  "Look, I have a very young
wife.  We both want children, but it happens there's a problem.  I
carry an inherited genetic trait for something called fragile X
syndrome.  I had an uncle and a brother who were affected.  I don't
want to pass it on to children of my own.  So we'd need to find a male
donor for the sperm--" "Not at all," Goth interrupted.  "I know the
gene responsible for it.

I can correct the defect."

"Are you sure?"

"Quite sure.  It's a relatively simple gene splice, in fact."

"Will you do it then?  For me?  And for my wife?  She's terribly
anxious to have a child."

"I'd rather not, frankly."

"Why?  If Jupiter is as good as you say it is, then why not prove it to
me first?"

"I'd prefer to test it on some volunteers with less at stake in the
outcome."

"I understand.  But look--if you're willing to correct the fragile X
problem, why not go all the way?"

Goth shook his head.  He removed his glasses and fiddled nervously with
them in his lap.

"Is there some ethical worry?  What's the worst that can happen?  A
spontaneous abortion?  Those happen all the time anyway."

"The worst that can happen is a child with some undesirable mental or
physical characteristics...."

"Couldn't you detect those before birth?"

Goth rubbed his chin, thinking.  "I should be able to.  Yes."

"So the risk is no greater than the risk any mother bears in
pregnancy.

And the potential benefits are far greater.  Really, Doctor, your
reluctance makes me wonder if you believe in your own program."

Goth stood up.  "It'll work.  I know it."

"Then prove it to me."

Goth sat back down again.  He said nothing for a long time.

Stewart waited.  He became aware of the research assistant, who had
returned to her stool.  Stewart had a strong impression that she was
unhappy in her work.  Maybe she just didn't like Goth.

"Very well," Goth said.  "I'll do it."

Stewart thanked him profusely.  He was enormously pleased.

What better, quicker way for him to evaluate the true worth of the
Jupiter program?

"But I'll have to insist on several things," Goth added.  "I insist on
performing all the medical procedures myself.  And if they're
successful I'll have to see your wife on a regular basis.  I'll need to
monitor the pregnancy closely.  And I'll also need to supervise the
delivery itself.  And all procedures, including the delivery, will have
to take place on this island."

"I see no problem."

"And finally--and this is most important--I'll want to have access to
the child on a frequent and regular basis to follow its progress.

That's the only way I can measure the true effectiveness of the altered
gene sequences."

"I'll agree to all that," Stewart replied.  "In return, I'd like to
make one small but important condition myself.  My wife of course knows
about the fragile X syndrome.  She'll be thrilled to hear that you can
correct it.  But I'd rather we not tell her anything more than that.  I
don't want to risk either scaring her or raising her hopes too high.

She knows quite a bit of biology herself, and I'd rather let her think
that the whole procedure is only to solve the fragile X problem.  After
she's had the child, and we know the program works, we call tell her
everything.  But let's wait until then.

Goth agreed.

How soon can we do it, then?"

"I'll need to prepare the lab for the gene-splicing work, the egg
retrieval, the sperm enhancement, and the zygote intrafallopian
transfer procedure.  And I'll need to test both of you--get a genome
printout, take sperm and egg samples, and so forth.  At least three
months."

"Let's do it in three weeks.  Crash program.  I'll get you all the
equipment you need in a week.  Just give me a list.  And I'll get my
wife down here immediately so you can begin your testing."

"If you can get me everything I need that fast .  . ."

Stewart shook Goth's hand again.  This time the doctor squeezed back.

He was beginning to get enthusiastic about the idea himself.

Stewart left Goth's laboratory bursting with an excitement he hadn't
felt in years.  He had just negotiated the deal of a lifetime --of a
hundred lifetimes.  The path ahead would no doubt be strewn with
obstacles and dangers.  But with a reasonable amount of luck, not only
would Jupiter deliver him an extraordinary child, it would eventually
make him the richest human being on the planet.

Yuichiro Yamamoto teed up his ball on the first hole, a 415-yard par
four, on the Bethesda Country Club golf course, outside Washington,
D.C. He pulled a driver out of his bag and hit the ball deep and
straight down the fairway, where it rolled to a halt in the grass,
perfectly positioned for an approach shot onto the green.

His partner, Haikido Mishima, grunted a couple of words of praise and
knelt down to tee up his own ball.  Mishima was the number-three man at
the Japanese embassy in Washington.  He had been the number-one man
some years before at the embassy in Mexico City, so he retained
possession of the title of ambassador, even though his official
position now was that of consul for trade and technology.  His real
mission was coordinating the embassy's clandestine intelligence
activities.  He was several years older than Yamamoto, and not nearly
as accomplished a golfer.

Yamamoto could walk off the eighteenth hole of this course under par on
a good day.  But today he knew he'd be lucky to make eighty.  He had
suffered a sleepless night, followed by two overbooked and delayed
plane flights--one from Coronado to Nassau, the Bahamas, the other from
there to Washington.  Mishima, on the other hand, was out of shape and
not well coordinated.  He'd be lucky to get in under 110.

The ambassador hooked his tee shot to the right.  It landed short and
rolled into the rough, leaving him no approach to the green.

80

He slipped his club back into the bag with a dispirited sigh and
climbed into the golf cart.

"I don't know why I play this game," he said.  "It just makes me
ill-tempered.  I'd much rather sit in a garden and read poetry."

Yamamoto smiled politely.  He was quite fond of the ambassador.  He was
a cultured, educated man, with enormous grace and good humor.  He was
also charmingly self-effacing, even by Japanese standards, although
Yamamoto suspected that there was a hint of mockery behind that
modesty.  "I predict you'll give me a very close game today," he
said.

"Nonsense," the diplomat replied.  "You know better.  I'll be in the
woods most of the time, looking for that damned little pockmarked white
ball.  No matter.  I expect you'll make my morning worthwhile."

Yamamoto wasn't so sure.

"And I want all the details," Mishima added.  "Even the seemingly
irrelevant ones.  We have eighteen long holes ahead of us."

Yamamoto briefed Mishima on the meeting at Goth's laboratory.  He
described those present--Prince Bandar, Harry Fairfield, Baroness von
Hauser, and Dalton Stewart--and recounted the essential points of
Harold Goth's presentation.

By the time he had finished his briefing, they were riding the golf
cart toward the fourth green.  Yamamoto had parred the first, bogeyed
the second, and birdied the third.  The ambassador had triple-bogeyed
all three.

"How do you evaluate Goth?"  Mishima asked.  "Does he know what he's
doing?"

"I wish I could answer that question, Ambassador, but honestly I
can't."

"Why not?"

"His past achievements speak for themselves.  He's a Nobel laureate.

His brilliance as a geneticist is unquestioned...."  Yamamoto stopped
the cart by the edge of the green.  His ball was sitting on the green,
just twenty feet from the pin.  The ambassador's was buried in a nearby
sand trap.

"But .  . . ?"  Mishima prodded.

"But for a decade now he's been following an extremely risky course
with his genetics work.  That puts his judgment seriously in
question."

Mishima grabbed his sand wedge and waded into the trap after his
ball.

Yamamoto stood on the edge of the grass, watching.

"Maybe the potential reward is worth the risk," the ambassador said5
bending down for a closer look at his situation.

"Maybe."

Mishima stepped up to the ball, took its measure, gritted his teeth,
and swung lustily.  A dense shower of sand spurted out in front of
him.

The ball remained stationary.  "But you have doubts," he gasped.

Yamamoto nodded.  "All he has is an untested formula.  A computer
program, actually.  He calls it Jupiter.  It might do what he claims,
it might not.  We can't know until he tests it."

"And of course that's what he wants the money for."

"Precisely."

Mishima, breathing heavily from his exertions, stood over the ball
again and gave it another energetic wallop with his wedge iron.  This
time the ball shot out of the trap on a low trajectory, soared across
the green like a stray bullet, struck the pin with a loud bonk, bounced
ten feet straight up in the air, and came to rest three feet past the
hole.

Yamamoto shook his head in disbelief.

Mishima beamed in triumph.  "You think any of the others will make Goth
an offer?"  he asked.

"Baroness von Hauser already has.  And the American, Dalton Stewart--I
think he's up to something."

"What about the other two?  Prince Bandar and that Englishman,
Fairfield?"

"It's doubtful they'll do anything."

"What's the status of our own research programs?"

"At a standstill, like everybody else's."

"Why is that?"

"As you well know, Ambassador, experimenting on the human germ line is
illegal in most countries, including ours."

The diplomat appraised Yamamoto with a sidelong glance.

"But we're doing it anyway, aren't we?"

Yamamoto studied the green's perfectly mowed carpet of bent grass.

"Purely theoretical stuff--computer models based on genome studies,
projections from animal experiments, that kind of thing.  There's no
clinical experimental work being done with humans--" Mishima cut him
off sharply: "I know, I know.  We've become a more enlightened society
in the past sixty years."

"I personally think we should be doing clinical tests on humans.

No real progress is possible otherwise."

The ambassador removed the flag from the hole for his partner.

Yamamoto crouched down to view the terrain.  It was a tricky lie.

It started off level; then ten feet from the hole the green slanted
sharply to the left.  Yamamoto gripped his putter and concentrated.

"I'm not so sure," Mishima replied.  "Once an ethical boundary is
breached, it becomes that much easier to breach the next one, and then
the next, until one finds oneself, inexplicably, committing just the
sorts of atrocities we once committed in Northern China."

Yamamoto overhit his shot.  The ball rolled six feet past the hole.  He
glanced suspiciously at Mishima, who was still holding the flag.  If he
didn't know the man better, he would have sworn that Mishima had timed
his words to disrupt his swing.

Yamamoto diverted his irritation into a tough question: "Can we afford
to let the gaijin get ahead of us on this?"  He hadn't intended to be
so confrontational, but he felt deeply that this was a matter of the
utmost priority for Japan.  Failure to act would in the long run expose
his country to a terrible risk.

"No," Mishima agreed.  His tone was firm, emphatic.  "We cannot.  Our
people's survival depends on successful economic competition.  The
potential economic benefits of a successful genetics package like this
are obviously enormous.  And if genetic engineering is going to make
possible a superior race of men, then we must be that race.  There can
be no argument against that.  None."

"I completely agree."

"But all the same, we must proceed in this matter with a strong sense
of moral responsibility."

Diplomatic double-talk, Yamamoto thought.  What Mishima really meant
was, "We'll do what we have to do, but this time let's not get caught
at it."

"I agree with that also," Yamamoto said.

"So that brings us back to Dr. Goth and his remarkable but untested
program.  What do you recommend?"

"That we wait," Yamamoto replied.  He tapped his ball impatiently and
watched it overshoot the cup by four inches.  "Let one of the others
finance Goth.  Let them test Jupiter.  If it doesn't work, we'll have
risked nothing--and lost nothing."

"And if it does?"

Yamamoto shrugged.  "We could always borrow a copy."

Mishima stood by his ball, scratching his chin thoughtfully.

Yamamoto began to twitch restlessly, waiting for his partner to make
his four-foot putt.

The ambassador eventually got his putter lined up against the ball and
hit it.  "Borrow a copy," he repeated.  He laughed quite explosively.

"Yes.  We could always do that."  He watched his ball advance feebly
toward the hole.  His diplomat's mind had already converted the
proposed theft into something vaguely acceptable.

"And once we have the software program, we can trust our own scientists
with it far more than we could ever trust Goth."

Mishima's ball reached the lip, trembled there, as if its progress had
been arrested by a single blade of grass, and then fell into the cup
with a gentle rattle.  Yamamoto cursed under his breath.

Mishima tossed his putter into his bag with an uncharacteristic
flourish and hoisted himself into the golf cart.  He marked his card
with the tiny stub of a pencil he was using and chuckled contentedly.

"I believe I outscored you on that hole.  Did I?"

"You did indeed, Ambassador," Yamamoto answered, smiling between
clenched jaws.

Dalton Stewart was met in the reception area by the minister of
information, Pierre Etienne Toussaint, and ushered into the
presidential palace's cavernous dining hall.

Their footsteps echoed like gunshots on the carpetless stone floor.

President Despres appeared to have a passion for white, Stewart
observed: white marble walls and floors, white marble pedestals with
white marble busts of Roman emperors.  A ridiculously long dining table
was covered with a white damask tablecloth, and the chairs all had
white cloth cushions.  The only touches of color were two faded
tapestries on the end walls, and four potted jungle plants that
occupied the corners of the gigantic hall.  The effect was
oppressive.

It made the vast, eerily quiet, airconditioned interior feel like a
mausoleum.

Toussaint directed Stewart to a seat four chairs down from the head of
the table and then disappeared.  Stewart stood behind his chair and
waited.  He could hear occasional footsteps echoing on distant marble,
but none came through the large doorway.

After an interminable duration, he heard a sudden flurry of
footfalls.

They beat on the stone floors in a hurried staccato, like soldiers
marching double-time.  The sound grew steadily louder.

Four of Despres' palace guards burst abruptly into the dining hall and
positioned themselves one on each side of the room, forefingers
ostentatiously curled around the triggers of their automatic weapons.

A tense, expectant silence fell.  All eyes were riveted on the open
doorway.  Dalton Stewart found himself holding his breath.

After another delay, His Most Supreme and Enlightened Excellency
Antoine Auguste Despres, President for Life of the Republic of El
Coronado, came into the room.

After the dramatically staged entrance, Antoine Despres himself was a
distinct anticlimax.  He was short--about five-three--and slightly
built, with a mulatto's yellowish-brown skin.  His eyes were greatly
magnified by the thick lenses in his glasses, and his round, bald head
appeared too big for his scrawny neck.  His suit was white and
presumably well cut, but his sunken-chested posture largely defeated
the efforts of his tailors.

The minister of information pulled out the chair at the head of the
table and Despres sat down on it.  Toussaint then took a chair opposite
Stewart and gestured urgently for the American to sit down.  Stewart
sat.  He suddenly realized the president was now staring at him.

"We are honored to have you visit our island nation, Mr. Stewart,"
Despres said.  His voice was high-pitched and had an unpleasant grating
quality to it.

"Thank you, Your Excellency," the American replied, a little too
loudly.  His words bounced off the walls and reverberated through the
room.  He lowered his volume and told Despres how grateful he was for
the opportunity to meet him in person.

A servant appeared, carrying an ice bucket with a bottle of white wine
inside.  The minister of information opened the bottle, tasted it, and
nodded his approval.  The wine steward filled the three glasses and
moved silently to a corner of the room.

President Despres made a long toast, the import of which was his hope
that his country and the United States could overcome their differences
and restore the beautiful friendship they had once enjoyed.

Stewart reciprocated with a toast of his own, praising Despres'
enlightened leadership, his humanitarianism, and his outstanding
achievements in making El Coronado a true showcase of modern democracy
in the Western Hemisphere.

Despres answered with another toast.  The exchanges dragged on for some
minutes, severely taxing the American's inventiveness and requiring a
refill of wine.  By the time Despres had had his fill of flattery,
Stewart felt exhausted and slightly drunk.

When the appetizer appeared--a cold fish soup of some kind --the
president launched into a long, rambling defense of his administration
and the wonderful things it had done for the country.

He was a great patriot, loved by his people, but misunderstood
abroad.

All the problems of El Coronado could be laid at the doorstep of his
enemies, who were jealous of his popularity and his achievements.

The President talked almost nonstop for nearly an hour, ignoring his
lunch entirely.  With the arrival of dessert he finally wound down and
Stewart began his pitch.

"I come to you, Your Excellency, in the hope of getting your blessing
for a clinic and a research laboratory that my company, Stewart
Biotech, would like to open here in the near future."

The president raised a languid eyebrow.  "And why have you chosen our
little island for this?"

"Because this facility will be run by Dr. Harold Goth, the American
scientist whom you have so graciously allowed to use your medical
school for his research.  He assures me this island is the perfect
place."

"Does he?"  The president's tone was mildly ironic.

"He said that if it hadn't been for your understanding, for your
generosity and support, the important breakthroughs he's been able to
make in his research would most likely never have happened.  Now our
company wishes to underwrite Dr. Goth's research so that he may
accelerate his efforts."

The American continued his pitch.  While careful not to refer directly
to the island's abysmal condition, Stewart painted a glowing picture of
the economic vitality that the president, with his help, could bring to
his country if His Excellency was willing to give him a free hand.

Goth's laboratory and clinic would eventually be expanded, he said.  A
constellation of special clinics would then be built, and they would,
beyond any doubt, soon attract a great number of the world's richest
and most important people.  And these people would demand luxury otels,
restaurants, and stores to cater to their needs.  El Coronado would
eventually become one of the world's most exclusive resorts, and the
islanders' standard of living would become the envy of the Caribbean.

But before any of that could happen, he explained, much had to be
done.

If the promise of Goth's research held UP?  then a substantial capital
investment had to be made in the country's infrastructure.  The airport
had to be enlarged and modernized, the roads widened and repaved.  This
would cost many millions of dollars, which, despite His Excellency's
already heroic achievements in improving the economy, the island
obviously could not afford on its own.

But he, Dalton Stewart, could solve this problem.  He could make this
dream happen.  He could find the investors and get their commitments.

And even better, he could help His Excellency improve relations with
the United States government.  He even believed it was possible that he
could help get U.S. aid flowing once again to El Coronado.

But to do all this, the president had to appreciate that he would need
his full support and backing.  He needed promises that bureaucratic
obstacles would not be placed in his way, that red tape and the usual
graft and corruption would be kept to a minimum, and that he would be
allowed eventually to bring in thousands of foreign personnel to plan
and execute these ambitious projects.

Stewart was careful to play to the president's vanity and greed and to
make clear that Despres' ultimate authority would never be questioned
or threatened in any way.

If Despres was excited by the scenario, he hid it well.  "And what is
it, exactly, about these clinics that will bring all these wonderful
changes to this little island of ours?"

Stewart had anticipated the question.  Obviously Despres already knew
something of Goth's work, and he was certain to find out more as time
went on.  So it was important to tell him the facts.  The president had
many more questions, and it took over an hour for the American to
answer them all.

By the time Dalton Stewart left the palace, a fresh breeze had begun
fluttering the palms along the avenue, lifting the oppressive weight of
heat that had blanketed the island for the last three days.

Behind the breeze, purplish black thunderclouds towered high over the
western horizon, promising an imminent cloudburst.

Stewart climbed into the Land Cruiser, pulled off his white jacket, and
sank back against the seat cushion.  Trabert, the chauffeur, put the
jeep in gear and accelerated cautiously down the street, steering
between the potholes.

Ajemian looked at him inquiringly.

Stewart grinned.  "The little bastard can hardly wait for us to get
started."

His assistant settled his black leather attache case on his lap and
snapped it open.  "Well, we've got bad news on a different front.  I
just got a call from the real estate agent.  Baroness von Hauser made
an offer on the medical school property this morning."

The news jolted Stewart.  "How the hell did she manage that?"

Ajemian mopped his face with a damp handkerchief.  "She offered a
million two," he said.  "With a cash binder of a hundred thousand."

Stewart fought down his anger.  It was his own fault, he decided.

After beating out the baroness's offer to Goth, he had assumed that she
would just retreat from the field.  He had underestimated the woman.

"Who owns the place, anyway?"

"A local bank.  It was a foreclosure.  Sort of.  What really happened
is that the government confiscated it and turned it over to the bank.

The bank, as you might guess, is owned by President Despres."

Ajemian tucked the handkerchief back in his pocket and handed his boss
a thick stack of overnight faxes from the New York office.  To each
item Ajemian had attached a sheet suggesting appropriate or alternative
actions to be taken.  He uncapped a pen and handed it across with the
memos.

Stewart looked at the pile with distaste.  He wanted to focus on the
threat posed by the baroness.  "Any urgent stuff here?"

"No.  Routine."

Stewart worked swiftly through the pile, scribbling his decisions on
Ajemian's sheets as he went.

"We could still make a higher offer," Ajemian suggested.  "Nobody's
signed any contracts yet."

Stewart thought for a minute.  "No.  Let's let it go.  In fact, it may
be a break.  It'd take too damned long to rehabilitate that property
anyway.  You saw it.  It's a dump.  Most of the buildings are ready for
the wrecking ball.  Let the baroness have it.  We'll just relocate Goth
to a better spot."

Ajemian looked at his boss questioningly.  "Where?"

"There's a small private hospital on the other end of the island,"
Stewart said.  "What's it called .  . . ?"

"St.  Bonaventure?"

"That's it.  Good location, not too big, relatively modern.  Let's buy
it and turn Goth loose in it.  Make him head of it, if we have to."

"Will he go along?"

"Why shouldn't he?  It'll be ideal for him--air-conditioned research
labs, clinics, the works.  Find out who owns the place and set up a
meeting."

Dalton Stewart handed the pen and the stack of memos back to Ajemian,
who promptly returned them to the attache case and closed the lid.

The skies suddenly opened up.  Sheets of tropical rain cascaded like a
waterfall against the windows of the jeep.  Thunder and lightning
boomed and crackled over the island like an artillery bombardment.

Stewart was pleased with his solution.  He was going to stick the
baroness with a worthless piece of real estate, just when she thought
she had found a way to trump his deal with Goth.

But she had thrown him a scare.  And he knew he had not heard the last
of her.

Joseph Cooper awoke to hear the faint beeping of his satellite
telephone, lying on the night table by his hotel bed.  He picked it
up.

"Hello?"

"Mr.  Stare?"

"Speaking."

"Please call your father."

Juptler s LJaugner ù l Cooper muttered a groggy "Thank you," but the
voice had already vanished into the ether.

He dialed a memorized number located somewhere in Fairfax County,
Virginia, and waited.  The "call your father" business was a simple
security precaution--a way for his control, a man he knew only by the
name Roy, to make certain that it was Cooper on the other end of the
line.

"Stare?  You there?"

"Yes."

"Goth is moving."

"Oh?"

"St.  Bonaventure Hospital.  Do you know where it is?"

"Yes."

"Check it out, please."

"You want it bugged, too?"

"That would seem appropriate."

"Yeah.  Okay...."

The baroness loved decisive moments.

Her opponent at the other end of the tennis court was Hans Dieterbach,
secretary of foreign economic aid and development in the German
government.

Dieterbach had played her even, six games apiece, and they were now
playing a tiebreaker for the set.  The score stood at 8-7.  The
baroness was serving.

Despite the chilly spring day, Dieterbach, a muscular man in his late
forties, was sweating profusely.  He had expected to win without much
effort and had been irritated to discover that it was all he could do
just to stay in the game.

Crouched at the baseline, waiting for her to serve, the sturdy German
official looked stricken.  His normally florid features had turned
ashen.  His mouse-brown hair, dripping with sweat, lay slicked back
against his skull, as if he had just emerged from the shower.

The baroness bounced the ball on the baseline with a delicate, taunting
leisureliness, giving Dieterbach plenty of time to reflect on his
situation.  She looked across at her opponent and smiled to herself.

The possibility of losing to a woman would be causing him great
stress.

She tossed the ball skyward, arched her back, and swept the racket back
far behind her head, as if to deliver an overhead smash.  Instead, she
sliced, whipping the racket face across the ball in a furious glancing
blow, imparting tremendous spin but very little forward motion.  The
ball came off her racket

92 strings whirring like a gyroscope and began losing altitude before
it had even reached the net.

Dieterbach, expecting a deep drive on first service, was momentarily
paralyzed, thinking she had mishit the ball and that it was destined to
fall short.  By the time he realized what was going to happen, it was
too late for him to save himself.

He lunged forward, his face a mask of acute desperation.  The tennis
ball, dropping almost vertically, struck Dieterbach's side of the court
about a foot from the net.  Its spin caused it to bounce hard and low
to Dieterbach's right, on a course parallel with the net and well below
the top.  Even if he had been able to reach the ball in time, its
trajectory made it virtually impossible to return.

The secretary made the maximum effort nevertheless.  When he saw he
wasn't going to get to the ball in time, he launched himself into a
dive.  His racket went flying, and his 220-pound bulk pitched headfirst
into the net.

The baroness suppressed her amusement.  She recovered his racket, which
had fallen into her back court, and carried it around to the other side
of the net.  Her opponent was still lying facedown in the dirt.  "Are
you all right, Herr Dieterbach?"

The secretary braced himself on one knee, then stood up, tottering and
off-balance.  He brushed off his shirt and shorts and took his racket
back from the baroness.  "I slipped," he complained.  "Your damned clay
court.  I'm used to the all-weather."

"I'm sorry my court isn't up to your standards," she teased, walking
alongside him.

Dieterbach snorted.  "You're not sorry at all."

The baroness nodded.  "You're quite right, Herr Secretary.  I'm not
sorry at all."  She glanced at her watch.  "Time for lunch."

They strolled up the winding path from the tennis court toward the back
entrance of the eighteenth-century castle that served as the baroness's
country retreat.  The huge stone edifice, Schloss Vogel, was located in
the mountains of the Bayerischer Wald, eighty miles north of Munich.

The baroness kept a town house in Munich, where her company's
headquarters were located, but she spent much of her time here at the
castle.

The baroness served the secretary sandwiches and wine in an enclosed
glass terrace she had had constructed on one of the castle's higher
ramparts.  From this lofty height they could dine and view the
surrounding mountains and valleys for many miles.

Dieterbach eyed the baroness appreciatively across the small table.  He
had made advances toward her in the past, and she had deflected them
each time; but he hadn't yet given up hope.

"I have a favor to ask," she said, refilling his glass.

"I expected you would."

The baroness batted her eyes flirtatiously.  "I do enjoy your company,
too, Herr Dieterbach."

"Not as much as you could, Baroness."

"Don't be naughty.  I have something serious to discuss."

"I'm listening."

"You know President Despres of El Coronado?"

"Yes.  In our office he's referred to affectionately as 'that little
black swine."

" "He needs foreign aid."

"He needs a firing squad."

"Fifty million marks.  That's all."

"Never.  He's on the department's shit list.  Right near the top, in
fact."

"Take him off it, then."

"On what grounds?"

"I don't know.  Recent evidence of reform.  Whatever excuses you people
traditionally make when you change your minds."

"You're a very cynical woman, Baroness."

"I'm a very practical, realistic woman."

"Why should we help him?"

The baroness explained about Goth's program.  She didn't tell the
secretary that Dalton Stewart had already beaten her out of it.  She
made it appear that the deal would be in the bag for her if Dieterbach
could persuade his government to open the foreignaid tap for Despres.

"Why not give him the money yourself?  Fifty million?  You can afford
it."

"He's already extorting me to the hilt."

Dieterbach looked uncomfortable.  "It won't look good.  Despres is an
international pariah."

"But you can do it, can't you?  It's so little money."

The secretary rubbed his chin and thought about it.  "I suppose I could
hide it in a larger program--the Caribbean Development Fund.  But I'll
have to twist some arms even so."

The baroness smiled and patted Dieterbach's hand.  "I knew I could
count on you."

Dieterbach gave her a pleading look.  "I don't have to be back in
Berlin until tomorrow, and my wife's in England...."

The baroness slapped his arm lightly.  "No, no.  I have a killing work
load today.  Look, when you've got this thing done for me, come back
and we'll celebrate.  How's that?"

Dieterbach persisted a few minutes longer, for his ego's sake, then
gave up.

The baroness saw the secretary to the front portico, where his car was
waiting.

"You're a most desirable woman," Dieterbach announced in a solemn
tone.

"Thank you, Herr Secretary."

"But you're not at all what you pretend to be, are you?"

The baroness affected surprise.  "What do I pretend to be?"

Dieterbach stared at her knowingly.  "You have enviable public
relations, I'll say that.  The government should hire you to advise our
diplomats.  Auf Wiedersehen."

The baroness went up to her study on the second floor.  The arrogant
bastard, she thought.  Thinking he understood her.  How little he
really knew.  His attitude tempted her to take him off her books
altogether.  As soon as he got the loan to Despres in the works, she'd
review the situation.  God, how much had she paid him in bribes these
past three or four years?  It must be over half a million marks.

Still, Dieterbach did deliver.  That was more than one could say about
many government figures she'd dealt with over the years.

Karla Schmidt, her private secretary, came in.  "Everything for this
afternoon is on your desk, Baroness."

The baroness looked at the pile of correspondence and telephone
slips.

Several hours' work.

"Photographers are coming at two from that English magazine,
Baroness.

And Herr Hellmann from Deutschebank at three.  Lotte Brandt about the
new ad campaign at three-thirty.  And a woman from Earthly Scents at
four."

"What does she want?"

"A new perfume endorsement."

"Not another one?"

"You're enormously popular," Karla said.

"You think so?"

"You're a role model to women everywhere, Baroness."

"Do you think I'm a role model?"

Karla blushed.  "Of course."

Karla had worked for her longer than any other secretary.  She often
wondered why the poor woman put up with her; she knew she was a slave
driver.

By six o'clock the baroness had cleared the day's business.  She
summoned Karla back to her study.

"What about Stewart Biotech?"  she asked.  "Have you found out if it's
a public company?"

"It's not, Baroness.  The Stewart family owns eighty percent of the
stock.  The rest is in the hands of Stewart lawyers and Stewart's chief
assistant, Henry Ajemian."

"That's a pity."

The baroness had for a while entertained the notion of trying a secret
buyout of Stewart Biotech.  She was still furious that Stewart had
outmaneuvered her with Goth.

But she had hardly given up.  The profit potential in Goth's program
was simply enormous--far greater than anything she had ever invested
in.  Still, there was something bigger in Jupiter than money.  If it
worked, it would open up a new dimension in her life--something beyond
the now well-worn satisfactions of international business and finance,
or the invisible political power she was amassing.  Jupiter represented
an opportunity that was impossible to quantify.  And it beckoned to her
like some forbidden thrill, some ultimate kind of satisfaction beyond
normal mortal experience.  Jupiter was the chance to influence the
human race in a way it had never been influenced before.  It was the
chance to play God.

But if she was going to get possession of it, she knew she'd have to
scramble.  She had underestimated this Dalton Stewart.

He was smarter than she had thought.

The baroness sighed at her own Machiavellian scheming.  How naturally
the determination to dominate others came to her.  She had spent a
lifetime perfecting it.

She said good night to her secretary, spent a few minutes reviewing
some papers, and then turned off the desk lamp.  She leaned back in her
big leather swivel chair and stared at the painting on the wall.  It
was the work of an obscure artist from the late medieval period and
depicted the Virgin Mary holding the baby Jesus to her breast.  Mother
and child both wore halos.  It was pretty standard stuff from the
period, and not terribly well executed at that.  But something about it
spoke to the baroness.  Perhaps it was the expression of suffering on
the faces of mother and child.  The painting reminded her of the trauma
her birth had caused her own mother-the woman had nearly bled to
death--and the disappointment she had caused her father, who had wanted
a son.

She grew up wanting to be a boy; it was the central emotion of her
childhood.  She had prayed that she would wake one day and find that
God had made a mistake and that she was a boy after all.  Because boys
were strong and girls were weak.  If she had been born a boy, her
father would not have taken everything from hen-her childhood, her
virginity, even her fertility.  The shame of those years burned in her
still.  She had wanted so much to love him, but he had made her hate
him instead.

No one defended her through those years--no one, not her mother, not
the servants, not her governess.  No one.  Her father ruled.  Everyone
was terrified of him.

Outside the household it was the same.  Wilhelm von Hauser was far too
important a personage in the community for anyone to risk his
displeasure.  Even the family physician--a despicable little toad of a
man--colluded against her.  He treated her for venereal disease.  How
old was she then--ten?  He arranged an illegal abortion when she was
only thirteen.  The doctor who performed it was a drunk.

She found out when she was twenty-two that he had so scarred her uterus
that she could never have any children.

Survival demanded strength, so Gerta became strong.  She learned how to
kill her emotions.  And she learned how to be patient.  And one day her
prayers were answered.

When her father was sixty-six, he had a stroke that left him paralyzed
and confined to a wheelchair.  He remained alert and conscious, but he
was unable to move or speak.

She was appointed his legal guardian.  Since she would inherit his
majority interest in Hauser Industries upon his death, she convened the
board and had herself named the company's new CEO.

There was little opposition.  She had already proved herself in the
business world, and no one doubted that she was capable of running the
company at least as well as her father had.

Next, she fired all the top management--all the people who owed their
positions to her father--and replaced them with new people, loyal to
her.

When she had consolidated her position in the company, she turned her
attention to her father.  She devoted herself to showing him just what
it meant, just what it felt like, to be at someone else's
mercy--someone who had been taught cruelty from an early age.  He
learned a lot in those last days--about helplessness, about
suffering.

About pain.

She kept him alive for six more months; then she let him go.

No man was ever happier to die.

Baroness von Hauser walked over to one of the study windows and opened
it.  A chill breeze ruffled the drapes.  The thousand acres of field
and forest that comprised the estate of Schloss Vogel lay invisible
below her in the darkness of the new moon.

She was emotionally dead inside.  She regretted the loss, but it was
the only way she could ever have survived.  She liked to think of her
unwillingness to feel love or compassion as a rare kind of strength.

Love meant vulnerability, after all; and to be vulnerable was to negate
the very purpose of her life, which was to rise to a position of such
power that she could never be made vulnerable to anything or anyone
again.  Ever.

l What a terrible way to get pregnant, Anne thought.  It was like a
rape in slow motion.

Looking down, she saw her spread thighs and bare knees gleaming
unnaturally white in the bright bath of light over the operating
table.

Her feet were hooked in the table's stirrups, and Dr. Harold Goth sat
on a stool positioned between them, clad in surgical green gown and
cap.

He was slowly inserting a long, flexible probe into her vagina.

She could see his latex-gloved hands twisting it steadily forward, and
she could feel its hard, unyielding foreignness as it penetrated deeper
inside her.  Beside him was a small video monitor that allowed him to
follow the progress of the probe with ultrasound.

"Relax," Goth commanded.  "Don't tense your muscles."

He sounded irritated.  But of course that was the way he sounded most
of the time.  He had explained the entire procedure to her, but not
voluntarily.  She had had to drag the details out of him over a period
of days.  He seemed from the outset to have adopted the attitude that
the matter was really none of her business.

She almost wished now that she didn't know what he was doing.  It was
only making her more anxious.

Anne Stewart had found it hard to like Dr. Harold Goth.  He was a
stiff, introverted man with little warmth or charm.

She had spent the better part of four days at Dr. Goth's unfinished
clinic in the new wing of St. Bonaventure's Hospital, where he had
subjected her to seemingly endless batteries of tests and injections.

During those long hours in the clinic, she had tried to engage Goth in
conversation on topics like music and literature.  He wasn't much
interested.  The only thing she found out was that he had a passion for
Sherlock Holmes--a subject about which she knew nothing.  Her attempts
to impress him with her knowledge of biology had made him even more
uncommunicative.

He did discuss the fragile X syndrome with her.  He explained how he
would extract the DNA from her fertilized egg, how he would isolate the
gene on the X chromosome that carried the faulty DNA sequence, and
finally how he would use restriction enzymes to surgically splice and
replace the area of faulty sequence.

She tried to draw him out as well about the so-called Jupiter
program--the collaborative venture in which he and her husband were so
deeply involved.  But the mere mention of the subject seemed to make
him nervous.  He would only mutter something about "extensive gene
therapy," or that it was all "too technical for the layman to
understand."  He finally got her off the subject for good by telling
her that his contract with Stewart Biotech did not allow him to discuss
Jupiter with anyone.

"But I'm the wife of the man financing your work," she protested.

Goth just pushed his eyeglasses back up the bridge of his nose and
glanced away.  "Then let your husband tell you."

Today the doctor was collecting her eggs.  ("Harvesting your oocytes"
was the phrase he had used; it made her think of the eggs as ripe
little pumpkins.) Over the last several days her ovaries had been
stimulated by injections of Pergonal to increase the egg production,
and now Goth was performing what he called a "transvaginal
aspiration."

Using the ultrasound monitor as a guide, he directed the probe into the
vagina, up through the cervix, uterus, and fallopian tube all the way
to the left ovary, suspended in the body cavity just outside the
horn-shaped open end of the fallopian tube.  One by one he burst the
follicles surrounding the ripe eggs with the probe's needle and gently
vacuumed the eggs into the probe.  The eggs traveled back through the
probe and out along a length of thin tubing into a suction trap.

Even with the light anesthesia he had given her, the pain caused by the
procedure was considerable.  The nurse standing behind her mopped her
brow with a cool, damp cloth.  Anne tried to distract herself by
focusing on the suction trap.  It consisted of a small glass test tube
with a two-holed stopper in the top.  The tubing from the probe was
pushed just inside one of the holes.  A second piece of tubing ran out
from the other opening to the suctioning device.  When the suctioned
eggs reached the trap, they simply settled to the bottom.  She wished
she could see the eggs, but they were much too small--a mere
two-hundredths of an inch in diameter.

As uncomfortable as the harvesting of the eggs turned out to be, it was
a pleasure compared with the harvesting of Dalton's sperm the day
before.

She and Dalton had had sex the night before in their hotel suite, and
Dalton had made a big fuss about having to use a condom.

He had had a difficult time getting it on, and an even more difficult
time removing it.  The whole business had been messy, timeconsuming,
and exasperating.  It had put her on edge and made him angry.  And of
course it had ruined the sex.

Dalton stored the sperm-filled condom overnight in a glass jar in the
hotel suite's refrigerator and presented it to Goth the next morning at
the hospital.  The doctor gazed incredulously at the rubber
prophylactic lying at the bottom of the jar.  He told Dalton that he
had done exactly the wrong thing.  He needed fresh sperm, and
preferably after a day's abstinence.  How many times had he told him
that?  But it was too late now.  The procedure had to be done within
the next few hours, no matter what.  He directed Dalton to go
immediately into the bathroom and masturbate into a plastic
container.

Dalton was appalled by the idea.  He was damned if he would do anything
of the kind, he said, with everyone in the place standing around
waiting for him.  Goth insisted.  Dalton still refused.

Anne finally saved the situation by forcing a compromise.  If she and
Dalton could have the use of one of the hospital rooms for half an
hour, she would help him collect the sperm.

An empty room with a hospital bed was quickly found, and Anne and
Dalton went inside and closed the door.  Neither was in the mood for
civil conversation, let alone sex.  But it was a crisis, and something
had to be done.

Since Dalton was unwilling to masturbate on demand, Anne did it for
him.  After a prolonged, sweaty effort, she succeeded in getting a
quantity of her husband's semen into a plastic container.

The episode led to a bitter argument later.

"That was the single most embarrassing damned thing I've ever been
through," he told her.  "I hope the hell you appreciate it."

Anne was stunned.  "Appreciate it?  Do you have any idea of what Goth's
putting me through?  Don't you think I feel just as degraded by the
experience as you?  How selfish can you be?"

"You're the one who insisted on a child."

Anne swelled with fury.  For the first time she actually felt a
powerful dislike for her husband.  "You bastard," she shot back.

"You're the one who lied to me about the embarrassing condition of your
genes."

She had never called anyone a bastard before, let alone belittled a
physical shortcoming.  She had wounded him deeply, and she knew it.

They eventually apologized to each other, but the damage had been
done.

The incident created a permanent distance between them, and it
frightened her, especially when they had just made such an effort to
reconcile their differences and commit themselves to having this
child.

Anne looked down at the doctor again, bent to his task with his
characteristic nervous intensity.  The paper mask over his nose and
mouth were causing his eyeglasses to cloud up.  He removed them, wiped
them hastily on his sleeve, and hooked the temples back over his
ears.

She felt his hand pressing on her lower stomach.  "You'll feel a little
pain," he warned her.  She closed her eyes and bit her lip.

In two days, she would have to come back for a second procedure--the
reinsertion of her fertilized eggs into her fallopian tubes.  Goth had
explained to her what would happen in the meantime.  Tonight, her eggs
would be mixed with Dalton's washed sperm in a specially prepared
medium and left to fertilize in a petri dish.  The newly fertilized
eggs would be allowed to divide three times.  Then they would be frozen
with nitrogen gas.

Samples of their DNA would be removed from the cells; the flawed
segment of DNA on Stewart's X chromosome that produced the fragile X
syndrome would be cut out and the altered DNA spliced in its place.

The fertilized eggs, or zygotes, containing their new pieces of DNA,
would then be thawed out and allowed to continue dividing.

In a procedure called ZIFT (zygote intrafallopian transfer) Goth would
make a tiny incision in Anne's stomach and insert a laparoscopic
syringe loaded with the altered zygotes through her stomach wall to the
open end of her left fallopian tube.  There the eggs would be squirted
into the tube and allowed to drift down through it toward the uterus.

In about two days the eggs would begin arriving in the uterus.  With
any luck at least one of the zygotes would adhere to the wall of the
uterus and start growing.

Of course it would be much easier to squirt the eggs directly into the
uterus through the cervix, Goth told her; that was the normal in vitro
fertilization method.  But impregnation rates were low.

The ZIFT procedure more closely approximated nature and avoided
irritating the uterus.  Impregnation rates were much higher.  That was
especially important, he said, given the great amount of time and
expense involved in retrieving, fertilizing, and genetically altering
the eggs.

The sedative Goth had given her finally began to take effect.

She was becoming light-headed, almost giddy.  She could still feel a
slight cramping pain from the probe as he worked it deeper into her
lower abdomen, but now she felt insulated from it, almost as if it were
happening outside her body.

Her mind drifted.  She wondered about Goth.  Why was he in El
Coronado?

A scientist of his stature should be associated with some prominent
research center, not a small Catholic hospital on a remote Caribbean
island.

She thought about Dalton.  It was typical of him, refusing to disclose
any details about Goth and the Jupiter project.  He had never liked her
inquiring into his business affairs.  When they were first married it
had hardly mattered.  But as it became clear that Dalton's whole world
revolved around his business, for him not to share anything about it
with her was in effect to cut her off from everything that really
interested him.  And she was particularly annoyed in this case.

She did, after all, have a degree in biology from the University of
Vermont.  She was far better able to understand what Goth was about
than most people were, including her husband.

His refusal to involve her in matters of his company's business, or
even take her into his confidence, left them with nothing to talk
about, nothing to get excited about, nothing to share.  And it left
Anne frustrated.  She would have been so happy to have taken a lab job
at Stewart Biotech--any job.  But Dalton still wouldn't hear of it.

What kind of father would Dalton be?  she wondered.

Anne opened her eyes and blinked in the bright light.  She felt
extremely groggy.  Had she been unconscious?  Dr. Goth was standing up
and pulling off his latex gloves.

What a terrible way to get pregnant, she thought again.  And what a
terrible time to get pregnant--just when her marriage was beginning to
feel as fragile as her husband's X chromosome.

Dalton Stewart followed Goth's research assistant, Kirsten, into the
hospital cafeteria.  He poured himself a diet cola and watched her
carry her tray to a seat by a window against the far wall.  It was the
middle of the afternoon, and the place was almost deserted.  He walked
over to her table.

"May I sit down?"

She peered up over her glasses with a.suspicious frown.

"I'd like to talk to you," he said.

"Okay."

"What's your last name, by the way?"

"Amster."

"German?"

"Danish."  She took a bite from her sandwich.

"How long have you worked for Goth?"

"Two and a half years."  She obviously wasn't eager for conversanon.

"You enjoy it?"

"No.  What do you want?"

Stewart laughed in embarrassment."  'Don't feed me any bullshit,' is
that it?"

She nodded.

"I want to offer you a lab job with Stewart Biotech in New York.  Are
you interested?"

Kirsten took another bite of her food.  "Should I be?"

"I'll triple your present salary.  And give you a cash living
allowance.  New York is an expensive city."

"What's the catch?"

"That you don't tell Goth why you're leaving or where you're going."

"That's all?"

"No.  I need a little favor."

"Let me guess.  You want a copy of the Jupiter program."

Stewart looked at her.  She met his gaze head on.  "That's it," he
admitted.

"Okay.  For ten thousand dollars."

"The job in New York is what I'm offering."

"I don't want the job," she said.  "I want the money."

Greed was everywhere, he thought.  "Well, maybe I'll just go and ask
Goth for a copy."

She wasn't bluffed.  "He won't give you one."

"Are you able to make a copy--without him knowing?"

"Absolutely."

"You ever make one for anyone else?"

"No.  The earlier versions were no good, anyway."

"How soon can you do it?"

"Tomorrow or the day after."

"Okay.  Forty-eight hours.  I'll meet you right here."

"With ten grand?"

"With ten grand.  If you leave the island immediately."

"Then I want twenty."

Stewart took a deep breath.  "Fifteen.  Take it or leave it."

Kirsten shrugged.  "I'll take it.  Plus plane fare to Miami."

"I'll bring you the damned ticket myself."

Dr. Paul Elder came around the side of his desk: "Please have a seat,
Mrs.  Stewart."

"Thank you."

Anne held out her hand and the doctor took it briefly.  His appearance
startled her.  He was the sixth pediatrician she had interviewed, and
he hardly fit her image of a doctor.  He was unusually tall.  She
noticed that he had to duck under the door lintel when he came in.  His
hands were big, and his head was broad, with prominent cheekbones and a
mane of glossy black hair.  His gaze was intense.  It would have been
intimidating in the extreme if it were not for his relaxed manner and
big, easy grin.

His chin and upper lip had shaving cuts on them (a tiny piece of toilet
paper still adhered to one of the cuts), and his gray, pin-striped suit
pants were wrinkled.  He seemed disheveled in the absentminded way of
someone who never thought about his appearance--or about himself.  If
Anne had met him outside his office, she would have guessed he was a
man of the outdoors--a bush pilot--not a doctor.

He wedged himself into his chair and folded his hands in his lap.  Anne
suppressed a giggle.  He looked so comically outsized for everything in
the room, including his desk and chair.

His eyes dropped briefly to her stomach, then came back up to meet
hers.  "Four months?  Give or take a week?"

Anne laughed.  "Oh, you're exactly right.  How can you tell?

Everyone says I'm hardly showing anything at all."

109

He chuckled.  "It's not really your tummy size I'm going by.  It's more
your face--your complexion, and a few other clues I'm not sure I can
articulate easily.  All I know is that you look like a woman four
months pregnant.  And you look--well, to use a very unmedical
term--terrific."

Anne felt herself blush slightly.

Dr. Elder cleared his throat and became more businesslike.  "So I
suppose you're checking me out?"

Anne patted her stomach.  "I want the best doctor for her."

Elder locked his hands together across his chest and began twiddling
his thumbs thoughtfully.  "I'm wondering why you had an amnio."

"I beg your pardon?"

The doctor grinned apologetically.  "I'm sorry.  You seem to know
you're having a girl, so I assumed you'd had amniocentesis.

I was just wondering why."

"I wanted to make sure everything was okay."

"Is everything okay?"

"Yes.  She's doing very well."

Dr. Elder was interrupted by his nurse-receptionist.  She told him
that a Mrs. Somebody was on the phone about her daughter--something
about a drug problem.  He excused himself to take the call.

It was the first of a series of telephone interruptions.  Between them,
Dr. Elder filled Anne in on his medical education and his
experience.

He had been a doctor for fourteen years but a pediatrician for only
eight.  He had started out as a research specialist but ended up
feeling he wasn't doing anybody much good, so he retrained himself for
pediatrics.  He had never regretted the decision.  "I love kids," he
said simply.

Anne looked around the office.  There were photos of children and
drawings by children plastered on every available surface.

"Are any of these yours?"  she asked, nodding toward the walls.

"Nope.  They're all patients."  He grinned proudly.  He pointed out
some of the photographs and told her about the children in them.  "A
lot of these kids are from one-parent homes," he said.

"And their mothers can't afford good medical care.  Who can, these
days?  I sort of get to be a part-time father to some of them--mostly
in the form of advice.  For a lot of these kids, their biggest health
problem is a bad home.  I try to do what I can on that front, but
needless to say, I can't do very much.  It's frustrating.

He took another phone call.  Two things were becoming clear: Dr. Elder
was dispensing a lot of health care free, and he was overburdened with
patients.  The big waiting room outside was jammed with noisy children
and their mothers.  It looked and sounded more like an out-of-control
day-care center.

Anne studied Elder.  Not married, she thought.  No time for a social
life.  No wonder he looks so unkempt.  He takes care of everybody, but
he doesn't have anyone to take care of him.  She felt like getting up
and tucking in his shirt for him and running a brush through his
hair.

"I'm sorry," he said when he hung up.

"I feel I'm taking up too much of your time."

Elder laughed.  "No, no.  Today's a slow day.  I just hope you don't
mind a lot of interruptions.  It drives some people crazy, I know."

He had no sooner said this than a piercing scream from the waiting room
caused him to jump up and run out.  He was gone for about fifteen
minutes.  She could hear him talking earnestly to someone on the other
side of the wall.

Anne decided that she wanted him as her pediatrician.  She already knew
before she came in that he was widely respected.  Now she knew that he
was also kind, intelligent, caring, and unselfish.

He was certainly a light-year's improvement on the doctor she had had
growing up in Burlington, Vermont.

Elder's only drawback seemed to be that he was already so overworked.

It would be a struggle just to get his attention.  She had an almost
irresistible impulse to run right out into the waiting room and offer
him her help.

The doctor ducked back through the door and squeezed back behind his
desk.  His expression was grim.  "That was Jason.  Father's an
alcoholic.  He beats the poor kid--and his mother as well.  They don't
have a dime, and the social services people aren't very responsive.

I've reported the case four times now, and nothing's been done.  I'm
trying to get someone to at least monitor the situation, until we can
get a court order against the father."

"How horrible!"  Anne was pleased, though, that the doctor was so open
with her.

"I'm rambling on.  Sorry.  Do you have any other questions you want to
ask me?"

Anne shook her head.  "I want you to be my baby's doctor.  If you can
possibly find time for another patient."

Elder laughed.  "I only work twelve hours a day.  And I take every
other Sunday off.  Usually.  So you see, I'll have plenty of time.  Do
you live nearby?"

"No.  Lattingtown."

"Oh.  Where is that?"

"Long Island."

Elder's eyes narrowed.  "You really want to come all the way into
Manhattan for a pediatrician?"

"Yes.  I want the best."

Elder shook his head.  "I'm not the best.  There're a lot of good
pediatricians around."

Anne decided it was time to explain why it was so important that her
baby have the best doctor she could find.  She told him about Dr.
Goth's in vitro fertilization.  "My husband's family has a history of
something called fragile X syndrome.  I assume you know what it is--a
genetic abnormality on the X chromosome.

It causes mental retardation.  Dr. Goth said he could repair that
defect.  That's why we went to the trouble of having the procedure.

Otherwise, we couldn't have had any children.  Naturally, we're very
concerned about the baby...."

During the course of her explanation, Elder's friendly, interested
manner evaporated.  He was regarding her now with a disapproving
frown.

"Dr.  Goth?"  he repeated.  "Harold Goth?"

"You know him?"

"I know who he is.  Where was this procedure performed?"

Anne felt uncomfortable.  His sudden hard tone of voice had put her on
the defensive.  "In the Caribbean.  El Coronado."

.

"

:,

l Elder shook his head, incredulous.  "El Coronado?  Never heard of the
place."

"Doctor Goth has a clinic there--at a hospital...."

"Whose idea was this?"

"Idea?  My husband's.  Dr. Goth is working on something for one of my
husband's companies...."

"Who's your husband?"

"Dalton Stewart."

"Of Stewart Biotech?"

"Yes."

Elder slumped back in his chair and ran his hands along the armrests.

Anne was startled by his abrupt change of mood.  "Is something
wrong?"

"What did Goth do to you?"  he asked.

"Just what I told you.  He repaired the gene causing the fragile X."

"Is that all he did?"

"What do you mean?"

"He didn't tamper with anything else?"

Anne stared at Elder.  Why had he turned on her like this?

"No," she said, in a small voice.

"Are you sure?"

"Why would he?  I don't understand."

Dr. Elder avoided her eyes.  He stood up, indicating that the
interview was over.  "You and your husband can afford any pediatrician
you want," he said.  "A whole staff of them, if you feel like it.  You
don't need me."

Anne was stunned.  "But I want you."

Elder opened the door to his office, inviting her to leave.  "Sorry.

I'm much too busy.  Good day, Mrs.  Stewart."

A minute later Anne found herself standing outside on West
Seventy-ninth Street.  She was trembling with hurt and anger.  She
couldn't remember a more devastating rejection in her She thought they
had been getting on so well.  She had never met a doctor she had
related to so immediately, so completely.

Why had he become so suspicious of her all of a sudden?  As if she were
hiding something from him?

How dare he throw her out like that?  She was strongly tempted to march
back into his office and demand an explanation.

She felt betrayed.  It was as if her trust had been violated.  Some
part of her recognized that her reactions were ridiculously out of
proportion to whatever offense he had committed, but she simply
couldn't help it.  She wanted the best for her daughter.

She groped in her purse for a tissue and couldn't find one.  Tears
started rolling down her cheeks.

"Goddamnit," she said.  Several passers-by glanced in her direction.

"Goddamnit," she repeated in a louder voice.  "Goddamnit!"

Dalton Stewart came into Anne's bedroom.  The curtains were still
drawn, shutting out most of the morning's light and the sound of the
strong, gusty wind that had begun rattling the windows and blowing the
leaves off the trees.  Anne was lying on her side, eyes closed.  He
bent down and kissed her lightly on the cheek.

She opened her eyes and squinted at the bedside clock.  "You're dressed
already?  It's only seven."

"Gil's taking me to the airport."

"Where are you off to this time?"

"Miami.  Then back down to El Coronado.  How are you feeling?"

Anne laughed.  "For godsakes, Dalton, I'm feeling fine.  I'm getting up
in a few minutes."

Dalton frowned disapprovingly.  "Why don't you rest for another day?"

"I've been resting for two days.  The doctor said I could get up as
soon as I felt like it.  Well, I feel like it."

"For my sake, then.  Humor me."

Anne put her hand to her mouth and yawned.  "Dalton, I'm not going to
stay in bed just to humor you."

Dalton jammed his hands into his pants pockets and began pacing the
room.  "Damn it, Anne, why take any chances?  You know how much this
baby means to me."

Two days before, Anne had tripped on the attic stairs and taken a bad
fall.  She had sustained a few bruises, but that was all.  And 11 5 her
gynecologist had assured her that the fetus hadn't been harmed.

Anne rolled over on her back, her eyes following Dalton as he opened
one of the drapes to let the light in.  "Well, guess what, Dalton.  She
means a lot to me, too."

"I know.  I'm sorry."

"I promise I won't go up into the attic again, okay?"

"You ought to stay off stairs, period.  The house has an elevator.  Use
it from now on."

"The elevator happens to be broken.  And more dangerous than the
stairs, anyway.  The gardener got trapped in it last October,
remember?

It was three hours before anyone found him."

"I'll speak to Franklin.  We'll get it fixed immediately.  And I want
you to have someone with you from now on.  All the time."

"Like who?"

"I've asked Mrs.  Corley to hire a professional nurse."

Anne threw off the covers and sat up.  "Dalton, that's crazy.

I'm not sick, I'm pregnant.  I don't need a nurse."

Dalton came across the room and sat down on the bed beside her.  "I
don't want to have to worry about you all the time.  If you won't have
a nurse, then at least a bodyguard."

"It was an accident, Dalton.  For godsakes!  If someone were trying to
hurt me, or the baby, they'd think of something a little more ingenious
than putting a rod from an old barbell set on the top attic stair.  The
chances of me going up there were practically nil."

"But the fact is you did go up there."

"Why are you sniping at me like this, Dalton?"

"Because I'm depending on you to take care of the baby."

Anne started to reply, then changed her mind.  She stormed into the
bathroom and slammed the door behind her.

Dalton paced over to the window.  Anne's defiant attitude was something
new.  And it both galled and depressed him.  He pulled the curtains
back further and stared out over the grounds.  It had begun to rain.

The wind spattered the drops against the glass, partially obscuring the
view.

He had somehow expected that Anne would always be grateful to him for
having plucked her from poverty and obscurity and introduced her to a
world of security and privilege that most women would envy.  But she
was not grateful.

He supposed he had made a mistake in marrying her.  At the time she had
seemed perfect.  She was young, beautiful, intelligent, vivacious--just
the kind of wife a man in his position needed.  A woman who could turn
heads wherever they went.

But now all he saw were her shortcomings.  And ingratitude was the
least of them.  She did nothing for him socially.  Not having been
brought up in a world of class and privilege, she was at a loss as how
to function in it.

The situation had to change.  Either Anne would have to take up their
cause on the social front, or he would have to consider divorcing
her.

Christ, he'd been through two divorces already.  He didn't know if he
could stand another one.  But he saw now that what he really needed was
a woman of established social prominence, a woman with the right family
and breeding, with the instinct and the desire to enhance his own
image.

He knew he was being selfish.  And he did still have strong feelings
for Anne.  She remained a most desirable woman.  But he had to be
hardheaded about these matters.  It was his future, after all.

He would have to face the matter later--after the baby was born.  Until
then, Anne's welfare had to remain uppermost in his mind.

Anne emerged from the bathroom completely nude.  This was unusual for
her; she was naturally a modest person.  She was still angry at him, so
she was pretending he wasn't there.  Her six months of pregnancy didn't
show very much at all.  She had gained a few pounds, especially around
the middle, but otherwise her body looked as shapely and voluptuous as
ever.  He felt a sudden strong urge to make love to her.  It was the
only way he could think of to try to bridge the widening gulf between
them.

Was she trying to communicate the same desire to him?  He didn't know,
and he was afraid to ask.  She was never very receptive after an
argument, anyway, he told himself, and he absolutely couldn't risk
doing anything that might threaten the pregnancy.

He tried to smooth things over.  "I'm sorry, Anne.  I shouldn't be
blaming anyone for anything.  You know how I am.  If I don't feel in
control I don't feel comfortable.  So I worry about you.

And the baby.  That fall of yours scared the hell out of me.  I
couldn't help thinking that you might have lost her.  And I couldn't
help thinking how devastating that would be.  She'll likely be the only
child the two of us can ever have."

Anne snapped her bra together.  The apology seemed to soften her
somewhat.  "But I can't just stay in bed for the next two and a half
months.  We live in the real world--or at least a very privileged
version of it.  We can't command that nothing bad happen.

We can't foresee or forestall everything.  I might just have a
miscarriage."

"Don't even mention the word."

Anne looked at him speculatively.  "Well, if we are unlucky and
something bad does happen, we can always get Dr. Goth to work his
little magic again, can't we?"

"What do you mean, 'magic'?"

"What do you think I mean?"

Dalton averted his eyes.  For one terrifying instant he thought she
knew that Goth had used the Jupiter program on her.  Could she have
possibly found out?  No.  Goth would never tell her.  And no one else
knew.

He had wrestled with himself many times about whether he should let her
in on the truth.  Because it was really quite a remarkable, exciting
thing that Goth was doing.  But why risk scaring her?  If the baby
turned out to be as extraordinary as he expected, then let Anne be
overjoyed at the results.  If the fetus miscarried, or turned out less
than perfect, then it was obviously better that she didn't know and
blame the failure on Goth--and on him.

And it was really too late to tell her now, anyway.  He had to focus on
one single, crucial matter--making sure that nothing happened to Anne
for the next ten weeks.

"Why don't you come down to El Coronado with me?"  he suggested.

Anne paused midway in buttoning her blouse.  "Why?"

"Then I won't worry so much about you.

Goth can monitor you on a regular basis.  In fact, you ought to stay
the whole time.

I'll rent out the whole top floor of the hotel."

"I don't want to spend two and a half months on that island.

I'll go crazy.  There's absolutely nothing to do."

"You're not supposed to be doing anything."

"Yes I am.  I'm just starting on a plan to redecorate this house, for
one thing."

"That can wait."

"Dalton, I don't like the island very much.  And it's hardly a good
place to be pregnant.  I'm much better off here.  The food and water
supply are much more dependable, and so is the sanitation and the
health care."

"You'll be staying in a luxury hotel, Anne, not a shantytown."

Anne shook her head.  "The baby's safer if I stay here."

"On one condition, then.  You accept a better security arrangement."

"Like what?"

"A twenty-four-hour personal guard service.  And a nurse.  Nobody has
to be at your bedside.  A nurse in the house, on call-that's all.  And
an armed bodyguard."

"No bodyguard."

"That's essential."

"My God, Dalton, we already have a million-dollar security system
around this place!  It's like a fortress.  Who's the bodyguard supposed
to protect me against?  The household help?"

"Okay.  Just in the house, on call.  And to accompany you on trips."

Anne sat down heavily on the bed.  Her anger had turned to dejection.

Dalton sat beside her and put his arm around her.  "It's only for a
short time, Anne."

Anne stared across the room for a few seconds, then nodded.

"Okay," she whispered.

Dalton tried to kiss her, but she turned her head away.

"What's the matter?"

"I'm not feeling very friendly, Dalton.  I'm sorry.  Just leave me by
myself for a while.  We can talk later."

"I won't be here later."

"Call me from Coronado, then."

Dalton stood up and headed for the door, burning with frustration.  He
realized that the fate of his child--and the enormous investment that
was riding on that child--depended more on her now than on him.  And
that, of course, made him dependent on her as well.

It was an intolerable state of affairs, but there wasn't anything he
could do about it.

1

Karla ushered the visitor into the baroness's exercise room, a
spacious, plush-carpeted area on the top floor of her Munich office
building.

The baroness was working on her rowing machine.  She was dressed in
black tights under white cotton shorts and a loose tank top.  Her blond
hair was pinned up.  She was rowing quite fast.  A slight sheen of
perspiration glowed on her neck and arms.

The visitor stood awkwardly on the carpet, not sure what to do.  The
baroness kept on rowing.  She eyed him critically.  His name was Otto
Mossler.  He was young and muscular--a jutjawed, blond-haired Aryan
type with sharp blue eyes and a surly demeanor.  He was wearing a brown
suit that fit him badly.

Mossler managed a small German trucking company, TransEurope Express,
for his father.  The baroness had employed him occasionally.

TransEurope's trucks had illegally carted thousands of tons of highly
toxic wastes from the baroness's laboratories and manufacturing plants
to secret disposal sites in Eastern Europe.

Mossler was also one of the leaders of Neues Deutschland, the New
Germany party, a right-wing, neo-Nazi movement that had gained steadily
in popularity over the past decade.  Once a refuge for the lunatic
fringe, in 1999 the ND boasted a membership of two million and had been
polling a respectable ten to fifteen percent in recent elections.

Mossler hesitated, made a curt bow, then stepped a little further into
the room.

The baroness pointed to a weight bench.  "Please sit down, Herr
Mossler.  Your posturing is making me nervous."

Mossler sat on the bench.

"We've had a good relationship with your trucking company," the
baroness said, still rowing energetically.  "I expect soon to have need
of some manpower to perform some discreet services for me.  I wonder if
you might be able to provide it?"

Mossler looked confused.  "Discreet services?"

"Dirty work," the baroness replied bluntly.  "Things that I cannot risk
having traced back to me."

Mossler grinned.  His eyes followed the motions of the baroness's
breasts beneath the tank top.  "Of course, Baroness.  I can provide you
with any service you like--dirty or otherwise."

"I'm glad to hear it.  I'll need several men to travel to an island in
the Caribbean.  There's something in a medical laboratory there that I
must have.  They'll have to break in, find it, and bring it back to
me."

Mossler's eyes widened in surprise.

"Does that sound too difficult?"  the baroness challenged.

Mossler stuck out his chest.  "Of course not."

"Good.  Find the men.  They must be completely trustworthy.

I'll have a detailed plan for you in a few weeks."

Mossler nodded.

The baroness quickly changed the subject.  "How are things at Neues
Deutschland these days?"  she asked.

"We'll one day be the most powerful political organization in Germany,"
Mossler boasted.  "We have the right message.  The people are beginning
to listen to us."

The baroness got up off the rowing machine and dried her neck and arms
with a towel.  "But you still must need a lot of money to realize these
ambitions."

Mossler said nothing.

"In return for these discreet services, I'm prepared to make a sizable
donation."

"Thank you, Baroness.  It will be greatly appreciated."

The baroness walked over close to Mossler, still sitting on the
bench.

"And it will be kept secret."

He looked up at her.  "Of course."

"No one must know I've even met you.  Do you follow me?"

Mossler shrugged.  He looked unhappy.  "If you insist."

"I do insist.  If it ever gets out that we've had any dealings, that's
the end.  No more money.  Is that clear?"

"Quite clear, Baroness."

"Good.  I'm glad we understand one another."  The baroness reached down
and squeezed Mossler's bicep.  He flinched in surprise.  "You must be
quite strong," she said.

Mossler flushed and grinned.

"Can you box?"

"Box?  Sure.  Karate too."

The baroness squared off in front of him.  "Stand up.  Let's see what
you can do."

Mossler's jaw fell.  "What?  Against you?"

The baroness smiled invitingly.  "Why not?"

Mossler got to his feet.  "I might hurt you, that's why."

"Really?"  she taunted.  "Go ahead and try."

"I'd rather wrestle you," Mossler said, leering at her.

"Very well.  Try to pin me down."

"This some trick?"

"Herr Mossler, I'm beginning to think you're a coward."

Mossler scowled.  He pulled off his jacket.  "I'll try not to hurt
you."  He hunched his shoulders and lumbered toward her, angling for a
hold.  The baroness avoided him easily.

Mossler pressed his attack, feinting and lunging to grab her waist or
legs.  She sidestepped him and slammed the edge of her palm against his
ear.  He fell sideways onto one knee, scrambled to his feet, and lunged
again.  His face was red, furious.

They circled each other.  Mossler spun around and momentarily caught
her neck with his arm.  But she ducked under and rammed a fist into his
solar plexus.

He gasped and staggered backward.  The baroness whirled, brought a leg
up and around, and smashed her instep against the back of his neck with
enough force to send him sprawling.  His foot caught the edge of the
rowing machine and he crashed nosefirst into the carpet.  He took his
time getting up.

The baroness buzzed her secretary.  "Karla, please come up and show Mr.
Mossler out.  I'm going to take a shower."

Joseph Cooper got another midnight call from Roy.  "We're getting a lot
of interference on the bugs," Roy said.  "Something electronic in the
hospital."

"I'll replace them."

"Never mind.  We need something else.  Listen carefully."

"Go ahead."

"Goth uses a removable computer hard disk with an important program on
it.  When it's not in the computer, he keeps it locked up somewhere.

It's a black plastic cartridge, six inches wide, two inches high, four
inches deep.  I want you to get it, copy it, and put it back.  And
under no circumstances must Goth find out.  Can you do that?"

"It won't be easy.  He hardly ever leaves the lab."

"New Year's Eve," Roy said.

"What about it?"

"He won't be there then.  And hospital security'll be lax."

"What's on this disk?"

"That's none of your business."

"No.  I guess not."

"When you have the disk, call me immediately."

That afternoon the baroness drove to her country estate, Schloss Vogel,
and had dinner with two guests, Katrina Zymonywicz and Aldous
Sikorsky.

She had found them in Warsaw two years earlier.  They had been attached
to a theatrical company that had gone out of business and were reduced
to doing street performances to stay alive.

Aldous was twenty-four then; Katrina, twenty-one.

The baroness was immediately taken by them.  Blond, and slight of
frame, they both looked like teenagers.  They possessed a wonderfully
innocent, androgynous quality that spoke to her.

They were street-smart and intelligent, but hedonists at heart.

When the baroness was reasonably sure of their inclinations, she made
them a proposal: Come back to Germany and live with her.

She would guarantee them a luxurious, protected life, free of
responsibility.  In exchange, they were to provide the baroness with
sex.  They were to be hers exclusively--to be available to her whenever
she wanted them.  And everything she did with them was to be kept
secret.

They turned her down.

She kept after them, and eventually persuaded them to come to Germany
as her guests and give it a try.

The baroness, who fired servants and employees on a regular basis,
hadn't expected the menage to work out for very long, but so far it
had.  She knew that one day they would probably leave just as suddenly
as they had decided to stay.  In the meantime, she'd extract what
pleasure from them she could.

Although the two were now permanent guests at Schloss Vogel, she rarely
saw them except when she was in the mood for their services.  And she
preferred it this way.  She was interested in them solely as a means of
satisfying her carnal fantasies.

Sometimes she enjoyed directing them in various sexual acts with each
other, or playing games of bondage and discipline.  But usually all she
wanted from them was simply a massage and a tongue bath, and they had
become skilled at obliging her.

After dinner the three retreated to the baroness's bedroom on the third
floor and removed their clothes.

Ecstasy took the baroness longer than usual to reach this particular
night, because her head was filled with thoughts of Jupiter.

She had done all she could do about the situation.  Now there was
nothing left but to wait for the right moment.  She was sure that
moment would come, but the waiting frustrated her enormously.  She was
constantly second-guessing herself, wondering if she had overlooked
anything, wondering if there might have been a better strategy.

Stewart should play into her hands eventually, but in the meantime
events were not completely under her control, and that always made her
nervous.  The longer the wait, the greater the chance of the
unforeseen.

And the longer she had to wait, the more she lusted after Jupiter.

It was meant to be hers.

She closed her eyes and willed her body to relax.  Aldous and Katrina
applied their tongues, lips, and hands to her flesh.  They started at a
very languid pace and gradually, imperceptibly increased the intensity,
exploring every inch of her until she was shuddering with pleasure.

Finally, her nerve endings screaming for release, she cried out, tensed
convulsively, and exploded in a long crescendo of rapturous spasms.

When her orgasm had subsided, Katrina and Aldous turned their
attentions to each other.

The baroness lay back and watched them.  Later, when she was ready,
they would start in on her all over again.  She would sleep well
tonight.

Dalton Stewart signed the last of a stack of real-estate contracts and
leaned back against the limousine's plush seat cushions.  Hank jemian
took the pile and neatly stacked it inside his briefcase.

They were on their way to pick up Anne at the island's airport.

She was now eight months into her pregnancy and doing splendidly.  Her
suite at the hospital was ready.  Stewart had supervised the details of
the renovation himself.  It was a small luxury apartment within the
confines of the hospital, with every amenity and every protection, from
an elaborate electronics alarm system to a round-the-clock staff of
nurses and bodyguards.

Stewart had had two limousines flown down from New York.

One of them, complete with two shifts of drivers on twenty-four hour
standby, was exclusively for Anne.  The moment she went into labor, she
could be whisked the ten blocks from the hotel to the hospital in a
matter of minutes.

The second limo was a stretch Mercedes SEL-660 and had cost him half a
million dollars by the time the customizers at the body shop were
through with it.  It was armor-plated, with bullet-proof glass,
puncture-proof tires, and a 450-horsepower truck engine.

Its top speed was 140 mph.  It got seven miles to the gallon.  Stewart
intended to give it to President Despres as a special gift at the
opening ceremony for Goth's new hospital wing next week.

"How much land do we own?"  Stewart asked.

"I get eight thousand five hundred and forty-five acres," Ajem ian
said.  "That includes over a mile of beach front.  The best beach
front."

Stewart felt a surge of optimism.  Despite the headaches involved in
trying to operate in a country that barely qualified as a third-world
dictatorship, his efforts were beginning to show results.  "Not bad.

I'm surprised Despres hasn't interfered more."

Ajemian scratched his jowls with the back end of one of his cheap
ballpoint pens.  He always carried a pocketful of them, along with his
wads of Kleenex.  Stewart had given him two goldplated Mont Blancs, but
Ajemian never used them.  "One reason is that we bought a thousand
acres from him," Ajemian said.  "At a grossly inflated price.  Another
is that any time he wants he can just take it all back from us."

"He wouldn't dare.  He's still counting on me to get the U.S. foreign
aid taps flowing for him again.  We'll just have to keep dangling that
in front of him for a couple of years."

"Well, I strongly recommend we stop buying for the time being.

The word is out, and prices are starting to shoot up."

Stewart watched out the window as the countryside flew past them.

"Property's still a steal.  And once we start developing, vacant land
values--especially the oceanfront--will go way up.

We'll be able to make back our investment just by selling off a few
hundred acres.  I tell you what.  Let's buy another five thousand.  Put
together some big contiguous parcels on the other end of the island.

After we finish on this end, we can build a new clinic out there and
develop a second cluster."

Ajemian uncapped a ballpoint and started scratching numbers out on a
pad.  "We're running up debt too fast," he said.  "The banks are going
to cut us off.  They think we're crazy doing this anyway.  Our exposure
is ridiculous."

"Have the banks ever been right about anything?"

Ajemian pulled a tissue from his pocket and wiped his nose.  "I know.

But we're really stretched thin, Dalton.  We had massive debt going
into this affair.  And our earnings are way down.  The banks just
aren't buying our projections anymore.  We should be belt-tightening,
not throwing money around."

Stewart groaned impatiently.  He sometimes found Ajemian's obsessive
caution maddening.  This was one of those times.

"We've been through this all before.  There will never be another
opportunity like this, Hank.  Not in our lifetime."

Ajemian squirmed uncomfortably in his seat.  "I understand.

Sure.  But we can cash in on it without laying out any more capital
now.  There won't be any money coming in on this for at least a year.

And that's only if nothing goes wrong.  And something always goes
wrong.  We're skirting bankruptcy now.  I mean it."

Stewart was tempted to tell Ajemian the truth about Anne's pregnancy.

It might make him feel better about the amount of risk involved.  But
he decided against it.  It had to remain his secret.

"All right.  Forget the five thousand acres."

They discussed other business matters.  Ajemian read aloud from a pile
of faxes sent down from New York earlier.  Stewart dictated a reply for
each, leaving it to his assistant to flesh them out.

Stewart gazed out the side window of the limousine as he listened to
Ajemian read the faxes in his high-speed monotone.

Coronado's midday traffic was limited almost entirely to trucks, buses,
and bicycles, but progress was slow and exasperating.  The Avenida des
lose Martires de la Revolucion del Ocho de Noviembre, or Avenida Ocho
for short, was in a sad condition, now more dirt than macadam.  Added
to the choking dust from the neglected pavement were the eye-stinging
belches of diesel exhaust from the trucks and buses, the cacophony of
beeping horns, jingling bicycle bells, and shouts of ragged children
darting among the vehicles, hawking everything from cigarettes to
sex.

The buildings along the boulevard had been built in the nineteenth
century by the French, who governed the island for over a hundred
years.  The French left in 1967, and the country's entire
infrastructure looked as if it hadn't seen a day's maintenance since.

The stone and plaster facades of the once proud town houses were
chipped and dirty, and the windows were missing shutters.  Balcony
railings were frequently collapsed or broken; chimney pots sagged at
crazy angles; and many of the roofs had been repaired so many times
over the years with such a wide assortment of different-colored
materials that they looked like patchwork quilts.  The sidewalks were
thick with beggars and gangs of unemployed males with nothing to do.

Street brawls, public drunkenness, and petty crimes were commonplace,
even in broad daylight.  Only the enormous posters and murals of
President Despres looked fresh and new.  His bulging, bespectacled eyes
and self-satisfied grin were everywhere, gazing down on his
poverty-stricken subjects like some giant cat watching mice in a
cage.

Stewart imagined the new city that would eventually sweep much of this
poverty and misery away.  He saw high-rise hotels and office buildings,
bustling streets full of markets and theaters and restaurants, all
catering to the explosion of tourism that he was sure would soon
transform this benighted backwater into a Caribbean paradise.

Things were rapidly falling into place.  Goth's clinic was now up and
running.  In another month Jupiter's first pilot test program would
begin.  If all went well with that stage, then several teams of
publicists and advertising specialists Stewart had already hired would
begin the work of developing a selective campaign to market the
program.  The campaign would be very upscale.

Details would be put out in the most discreet fashion possible, through
a carefully screened list of prominent doctors who might be willing to
refer their richest patients.

The doctors should be more than willing, Stewart guessed, since he
planned to offer a finder's fee of $25,000 for each referral.

Such a generous sum would be possible because he planned to charge the
first couples $500,000 per treatment--payable in advance.  The rich
wouldn't quibble with the price.  Indeed, their ability to afford such
an expensive medical service would in itself be a status symbol.  And
having a genetically superior child would be, among other obvious
advantages, the very ultimate status symbol.  Stewart anticipated a
sizable waiting list within months.

At its present size and staff level, Goth's clinic would be able to
handle comfortably a dozen couples a week.  That would generate grosses
in the neighborhood of $25 million a month.  Within the first year
Stewart planned to expand the clinic to handle as

Juler s LurJ

many as forty-eight couples a week.  That would quadruple income to
around $100 million a month.  The procedure was a relatively expensive
one, since each treatment required extensive DNA analysis and genetic
surgery; but at those rates the profit margins would still be
enormous.

Start-up and development costs would be earned out in the first two or
three weeks of operation.

After that, salaries and operating expenses would consume less than two
or three percent of the gross take each month.  Bribes, commissions,
finder's fees, and local "taxes" to Despres would eat up another three
to four percent.  That left a net profit per month in the range of $90
million.

There would be no U.S. taxes.  The money would be channeled into a
foundation that Ajemian had established for the purpose called the
Coronado Genetic Research Institute.  The institute would keep its
money in bank accounts already set up for it in Panama, the Bahamas,
Switzerland, and Liechtenstein.

After a few years, when the carriage trade began to thin out, Stewart
would build a series of satellite clinics around the island and set
lower prices so that the world's vast middle-class market could be
tapped.  Fees could then be lowered to something like fifty thousand
dollars per treatment.

The details of the broader marketing program would all be carefully
worked out at the appropriate time.  But one thing was certain: if the
formula worked as Goth claimed, it would generate more money than any
single product or service ever offered to anybody anywhere.  There were
many millions of potential customers.  Stewart estimated the program
could gross as much as a trillion dollars in its first decade.  It was
an absurdly astronomical sum, but he and Ajemian had brainstormed it
several times.  He estimated that in those ten years he could plausibly
increase his own personal worth to two hundred billion dollars.

Two hundred billion dollars.

It would be the financial killing to end all financial killings-one of
the greatest transfers of wealth in history.  In one decade it would
make him the richest person on earth--arguably the richest individual
who had ever lived.  Since no one had ever accumulated that much
wealth, there was nothing to compare it to, no way to measure its
potential.  But it would be breathtaking.

The prospect made him giddy.

A permanent financial arrangement still remained to be hammered out
with Goth, but Stewart saw no special difficulties in that area.  Goth
was as happy these days as a six-year-old on Christmas morning.

Stewart Biotech had come to his rescue, and Stewart was counting on the
likelihood that Goth would not want to see that relationship
terminated.  Once Goth had the women in the pilot program pregnant,
Stewart would close a deal with him.

He would offer him a fat yearly salary and expense account, plus a
two-percent share of net profits from Jupiter.  This would very quickly
make the doctor very rich.

If Goth was greedy and held out for more, Stewart would be generous and
up the doctor's percentages a fraction, but he wasn't about to make any
major concessions.  He wouldn't have to.  He had the doctor in a legal
and moral armlock.  The new foundation owned the hospital and
everything in Goth's labs.  And all relevant government
officials--including President Despres himself--were now on the
foundation's payroll.  If Stewart chose, he could kick the doctor off
the premises--shut him out completely--and there wouldn't be a thing
Goth could do about it.

The one potential threat--Baroness von Hauser--seemed to have vanished
without a trace.  That bothered him.  The baroness had a reputation for
persistence.

The next few weeks would be an extremely anxious time.  He had
overextended himself perilously, as Ajemian continually reminded him.

If Jupiter was a failure, he'd be in trouble.

Everything now depended on that child growing inside Anne's womb.

Anne Stewart propped another pillow under her neck and sank back
against the sofa, trying to find a more relaxed position.  She rested
her hands on her swollen belly and took a deep breath.

The pregnancy had gone so fast and so smoothly, she found it hard to
believe that the baby would soon be due.  Despite the tensions with
Dalton, she had never known a more serene period in her life.

Lexy Tate spread some beluga caviar on a triangle of toast and offered
it to her.  The hotel had sent up a table loaded with a variety of
treats and delicacies, and Lexy was determined to take advantage of
it.

Anne shook her head.  "No thanks.  I'll never develop a taste for that
stuff."

"Pity," Lexy replied.  She made a wolfish grin and stuffed the wedge
greedily into her own mouth.

Anne felt a twinge of guilt.  On her invitation, Lexy had come to El
Coronado two weeks ago, moving into a suite on the same floor of the
hotel as the Stewarts.  She had planned to fly home to New York
yesterday; but since the birth was now so close, Anne had begged her to
stay on until the baby was born.

"The biggest New Year's Eve in a thousand years and he goes to a party
without you," Lexy said.  "I think it's pretty shabby."

"You know how he is about me taking chances.  He still hasn't gotten
over the attic stairs incident."

"That's no excuse.  You're completely ambulatory.  There's no 135
reason he couldn't have taken you.  My mother, for godsakes-she played
golf right up until her water broke.  She insisted on finishing the
round before she'd let them take her to the hospital.

I was born in the golf cart on the way back to the clubhouse."

Anne laughed.  "You were not.  You were born in Doctors' Hospital on
Manhattan's Upper East Side.  And your mother was in labor for
twenty-three hours."

"Who told you that?"

"Your mother."

"She's a terrible liar."

"Why didn't you go with Dalton?"  Anne demanded.  "He did ask you."

Lexy piled caviar on another piece of toast.  "He was straining to be
polite."

"I hate for you not to be out celebrating because of me."

Lexy shrugged.  "I really don't mind.  I've been to enough parties--New
Year's and otherwise--to last me until the next millennium.  I've seen
it all.  And felt it all too.  I was once goosed at a dinner party by
the President of the United States--did I ever tell you that?  I've
also been groped under the table by a Belgian ambassador, and been
barfed on by a senator from a state I won't name.  Jesus, that guy was
a jerk!  And I once danced cheek-tocheek with a president of Italy, who
whispered obscene suggestions in my ear.  At least I think they were
obscene; my Italian isn't that great.  Oh, and I once let an English MP
have his way with me in a third-floor bedroom of my parents' house.

That was a drunken New Year's Eve a very long time ago."

"Which Italian president was it?"

Lexy stuck out her tongue.  She grabbed the TV remote, punched the On
button, and began flicking impatiently through the channels.

All stations were focused on the impending Big Event.  One channel was
covering street parties in the capitals of Europe, where the early
morning hours of January 1, 2000, had already arrived; another was
interviewing the leader of a group of endof-the-worlders standing vigil
on a snow-swept mountaintop in Northern California; a third was running
a documentary reviewing events of the past hundred years.  On a fourth
station a moderator was asking a panel of distinguished academics to
predict what the next thousand years might have in store.

The panelists' predictions were not upbeat.  The consensus was that
Homo sapiens was in for some hard years.  Man had so plundered and
fouled the planet during the century now ending that the only real hope
for the future seemed to lie in a quick and substantial reduction in
the human population.  The betting of the panel was that the early
decades of the next century would witness a kind of apocalypse in slow
motion, in which crime, disease, war, starvation, and environmental
catastrophes would proliferate to such a degree that the human species,
like an insect that had exceeded the carrying capacity of its habitat,
might experience a massive dieback.  Estimates of the size of the
decline varied among the panel members from twenty to sixty percent of
the earth's present population.

"That's a lot of funerals," Lexy said.  "I should tell my broker to get
me into mortuary stock."

Anne didn't laugh.  There was so little good news these days.  It was
depressing to be reminded of the state of the world into which her
daughter was about to be born.

The litany of horrors was lengthy.  The TV panelists unburdened
themselves like prosecution witnesses testifying to the criminal
depredations of the human race.  The evidence of guilt they presented
was overwhelming.

"God, what a bummer," Lexy mumbled.  She flicked through the channels
again, and left the set tuned to the station broadcasting the European
parties.  "Might as well get drunk--what do you say?"

Anne rubbed her stomach.  "Not supposed to."

"One little drink won't hurt.  Especially at this late date.  Come
on.

The hotel's left us a whole case of Dom Perignon.  A whole case!  How
many chances are you going to get to celebrate the beginning of a new
millennium?"

Lexy went to the refrigerator in the suite's small kitchen and returned
with a bottle and two champagne glasses.  She popped the cork expertly
and tipped the fizzing liquid into the glasses.

"Here's to that baby of yours, Genevieve Alexandra Stewart," Lexy said,
holding up her glass.  "May she be as sweet and beautiful as her
mother, and as big a smartass as me."  Lexy drained her glass and
refilled it.  "How did you settle on the name Genevieve, by the way?"

"She was the patron saint of Paris.  And I've always loved the sound of
the name.  I'm not sure why, but it makes me think of beauty and
strength.  I knew that if I had a girl she'd have to be a Genevieve."

Anne took a tentative sip of champagne and then suddenly stopped, as if
she had heard something.  A look of absolute astonishment transformed
her features.  She put her glass down, sat up, and leaned forward.  "Oh
my God," she whispered.

Lexy jumped up.  "What?  What's the matter?"

"My water just broke!"

At 10:45 P.M. Heinz Hoffmann wheeled the rented van into the hospital
parking lot and parked it next to the new wing that housed Dr. Harold
Goth's laboratory.

Hoffmann and his two partners, Dolf Greiner and Ernst Feldmann, had
been in Coronado for three days, casing the hospital and working out a
plan of attack.

Greiner, sitting on the passenger side, rolled down his window.

It was a cloudless night, with no moon.  The breeze off the ocean was
damp and a little chilly.  Light blazed from the windows of Goth's
wing.

Feldmann, sitting in the middle, bent his head forward to peer out the
windshield.  "The stupid pig is still working in there," he said.  "On
New Year's Eve."

Hoffmann looked at his watch.  "We'll just have to wait."

"What if he doesn't leave?"

"He's got to leave sometime."

Dalton Stewart pushed his way through the crowd toward one of the
bars.

Hundreds of guests in formal evening dress milled about, shrieking and
laughing and bumping into one another.

The decibel level, building steadily since the early evening, was
Juplter s Laugnher ù l inching into the red zone.  The orchestra, set
up on a low stage at the far end of the palace's gigantic ballroom, was
playing something, but Stewart couldn't hear a note.  The
thirty-foot-high ceilings and marble walls echoed and amplified every
noise into a smothering, cacophonous din.  He wished he had brought ear
plugs.

Famous faces seemed to beam at Stewart from every direction
--ambassadors, American congressmen and senators, movie stars, European
royalty, jet-setters.  Stewart was amazed that President Despres could
command such a glittering attendance.

After a long wait amid a forest of outstretched arms and beseeching
voices, Stewart rescued a scotch and soda from an overworked bartender
at one of the dozens of bars scattered about the rooms of the main
floor.  Coddling the drink close to his chest, he maneuvered back
through the crush of bodies, nodding and grinning absently as he
went.

He pushed open one of the French doors at the far end of the ballroom
and stepped outside onto a large stone terrace.

From this side of the palace, the view was breathtaking.  Across an
immense sweep of lawn, the Caribbean sparkled darkly under the stars.

A warm, soft breeze rustled the neat rows of palms that formed a border
between the lawn and beach.

In less than one hour a new millennium would begin.  It had been talked
about so much in the past weeks and months, and examined so
exhaustively by the media, that Stewart was heartily sick of the whole
subject.  Technically, the third millennium didn't begin until the
following year, 2001; but nobody was paying much attention to that
inconvenient little detail.  The human race was celebrating the event
tonight.  It was certain to be the biggest drunken hinge in human
history.

Religious fanatics were predicting much bigger things, of course.  Many
believed that at midnight the heavens would be rent asunder and the
entire earth engulfed in the fires of Armageddon.

Stewart thought the idea of the world coming to a fiery end precisely
at midnight quite laughable.  But he felt a sense of foreboding
nevertheless.  It was a vague, unfocused anxiety--a fear, not of
Armageddon, but of some undefined lesser catastrophe.  He supposed it
was related to Anne's pregnancy and the impending birth of their baby
girl, Genevieve.  So much was riding on that event.

But the worry seemed both more diffuse and more profound.

It wasn't just the baby that brought on this peculiar sense of dread.

It was the future.  He feared that events might somehow overwhelm him,
and cost him that energetic, driving, comfortable sense of certainty
and self-confidence that had powered his success in life.

His mind kept slipping back to another New Year's many years ago, when
he was sixteen.  Why the men who came for his father had picked the
last day of the year had something to do with the statute of
limitations.  At least that's the way his uncle Frank explained it to
him much later.

His life had been so protected up to that day that he hadn't known what
real misfortune was.  It only made the anger, shame, and grief all the
more intense.

The men were U.S. marshals.  They handcuffed his father in front of him
and his mother and took him away.  His father returned home that same
evening, after his lawyer had posted bail for him, but the event had
already altered the family's fate irretrievably.

There was a big New Year's party that night, and Dalton had the
prettiest date--Charlotte Kinsolving, the fifteen-year-old daughter of
the town's richest family.  Charlotte had promised to give him
something "special" that night.  He had no doubt what that something
was going to be.  News of his father's arrest had already spread,
however, and Charlotte was not allowed to go out with him that
night--or any night after that.  Dalton stole a bottle of scotch from
the liquor cabinet, jumped into his new Corvette--a present from Mom
and Dad for his sixteenth birthday--and drove around aimlessly all
night long, getting drunk and contemplating suicide.

The months that followed were an ugly blur.  His father was fired from
the stock brokerage house where he had worked for twenty years.  Under
pressure, he made a deal with the prosecutors.  He pled guilty to three
counts of stock fraud and one count of insider trading.  In return for
giving evidence and later testifying against several other brokers, he
was fined five million dollars and sentenced to five years in a federal
penitentiary.  Many former clients of the firm sued him as well, and
the Stewart family, once rich and respected, was suddenly bankrupt and
disgraced.

Along with his beautiful, rich girlfriend, Dalton lost his cherished
Corvette, his male friends, and everything else that meant anything to
him.  The family could no longer afford the country club where for
years Dalton had swum, played tennis, and partied.  The Stewart cook
was let go, and so was the maid.  Most humiliating of all, Dalton was
forced to quit the posh private boarding school he had been attending
for two years and enroll in the local public high school.

The family was socially ostracized.  During the good times, they had
made the serious social error of letting their wealth go to their
heads.  When the bad times struck, there was no sympathy from anybody,
absolutely none.  Even the people Dalton had assumed were old family
friends refused to stick by them.  And those who had not been friends
relished the Stewarts' fall from wealth and privilege with gleeful
satisfaction.  Shopkeepers and other service people, whom the Stewarts
had long treated with condescension, saw the chance to get even and
took advantage of it.

Their credit was cut off, and wherever they went they were treated as
pariahs.  The family's fall from grace was so shatteringly complete
that Dalton never fully recovered from it.

The family house and all the furnishings were sold to satisfy
lawsuits.

His mother obtained a divorce, and Dalton was sent to live with his
uncle.  So deep was Dalton's sense of betrayal that he never once
visited his father during his years in prison; and he saw him only once
after he was released.  His father committed suicide three years
later.

He was fifty years old.

Dalton's mother, still attractive at forty, married the lawyer she had
hired for her divorce and moved with him to the state of Washington,
where his family owned land.  Dalton and his younger sister went with
them.  Dalton's stepfather helped put him through college and business
school, but they didn't get along very well, and as soon as Dalton was
able, he moved out.

New Year's Eve, 1969.  It was burned into his soul.

All these years later he could still not think back on that time
without a feeling of sick terror in the bottom of his stomach.  No
matter that he was a hundred times richer than his father had ever
been.

At the beginning of each year he projected that if he could increase
his wealth by another ten or more million dollars in the next twelve
months, he would at last put the fear of repeating his father's
disastrous collapse behind him forever.  But the fear persisted anyway,
driving him to enrich himself further--driving him to take the kind of
legal and financial risks that kept his empire vulnerable to exactly
the kind of fate that had ruined his father.

Dalton Stewart saw the irony, of course.  The harder he strove to
escape the trauma of his past, the closer it seemed to loom.

A sudden amplification of voices and music from inside snapped him out
of his reverie.  He turned to see one of the French doors open and a
woman step through and walk toward him in the dim light.  She was
wearing a floor-length white gown that clung suggestively to her lithe
frame.  Her ash-blond hair was swept back in a regal style.

He had seen her in the hall earlier in the evening and had been quite
puzzled by her presence.  He had not yet spoken to her.

"So there you are, Herr Stewart," the baroness called.  "I have been
looking all over for you."

"What is he doing in there?"  Feldmann demanded, his eyes nervously
scanning the windows of Goth's lab.  "It's New Year's.

Why doesn't he go home?"

Greiner turned to Hoffmann, the driver.  "How long's the plane going to
wait?"

"Until two."

"Shit," Feldmann moaned.  "We'll never make it.  It's eleventhirty
now.

Traffic is already horrible.  It'll take us over an hour just to get to
the fucking landing strip."

"We can always leave tomorrow," Hoffmann said.

"After we blow up his lab?"

Hoffmann thought about it.  "Okay, then.  Let's go now."

"He's still in there!"  Feldmann moaned.

"We have pistols and masks.  We'll just hold him up, get the disk from
him, then get the hell out."

"What about my explosives?"  Greiner demanded.

"How fast can you set them?"

"I need at least ten minutes."

"Okay.  We'll take Goth with us, then.  Dump him at the airport."

Lexy went immediately into action.  A driver was posted on duty around
the clock for Anne, but no one at the desk could locate him.

Finally, with the help of a bellboy, Lexy got Anne down to the lobby
and settled into a chair.

Then, with the bellboy and one of the night clerks, she spent fifteen
minutes frantically scouring the hotel in search of the driver.  The
night clerk finally located him at one of the hotel bars.

He was hopelessly drunk.

He insisted he could drive, but Lexy disagreed.  She was so furious at
him that she cuffed him on the side of the head and knocked him right
off his bar stool, much to the amusement of the other patrons.

Lexy bellowed at the night clerk to telephone Dalton Stewart at the
National Palace.  She then ran downstairs to the hotel garage, located
the Stewart limousine, jumped behind the wheel, and gunned it around to
the hotel's front entrance.

The night clerk and a bellboy helped Anne out from the lobby and into
the back of the limo.  The night clerk said he couldn't get through to
anyone at the National Palace.

"Keep trying," Lexy ordered.

The hospital was only ten blocks from the hotel, but the situation
outside was chaotic.  A multiple-car accident two blocks away had
snarled traffic through the whole center of the city, and drunken
pedestrians were spilling onto the streets in growing numbers.

Lexy sat in the driver's seat of the enormous vehicle, glancing
nervously back and forth from the scene out in the street to Anne,
lying across the limo's backseat cushions.  "Are you okay, Annie?"

"I'm okay," Anne reassured her.

"No labor yet?"

"Just beginning.  Don't worry.  I'm sure we've got plenty of time."

Lexy looked out the windshield and shook her head.  "Jesus and Mary.

We'll need it."

Hundreds of stalled motorists were leaning on their horns.  An
ambulance and two Seguridad police jeeps, their sirens blaring and
lights flashing, were trying to work their way through, with no
success.  People were everywhere--running, dancing, singing,
screaming.

On top of the deafening chorus of automobile horns and sirens,
thousands of radios had been turned up to full volume all across the
city.  The crackle of the static sounded like flames from a burning
building, and the music hammered the eardrums.

Occasional bursts of gunfire and the hollow thock of bottles smashing
against the pavement punctuated the wild cacophony.

It was part celebration and part riot.

Five minutes passed .  . . ten minutes .  . . twenty.  No movement.

Lexy tried to back up, but the limo was blocked from behind by a long
line of vehicles.  In her frustration, she began pounding on the car
horn like everybody else.

Anne tried to calm her, but Lexy was gripped with a determination too
powerful to be denied.  She opened the car door.  "Be right back!"  she
yelled.  She ran down the line of idling vehicles until she found a
motorcycle.  She gave the motorcyclist's shirt a hard tug.  He jerked
his head around in surprise.

"Want to make a fast hundred bucks?"  she yelled.

"What?  " She jabbed her finger back in the direction of the
Mercedes.

"Back there!  Pregnant woman!"  She pointed up the street ahead.

"Hospital!  Emergency!"

After a few more minutes of desperate hand gestures and pleading, Lexy
got her message across.  The man turned his motorcycle around and
walked it between the cars back to the Mercedes.

They helped Anne out of the backseat and got her positioned astride the
bike.

"How's it feel?"  Lexy hollered.

Anne shook her head: very uncomfortable.  The motorcycle's owner
suggested she try sitting with both legs on one side.  They helped her
maneuver one leg around.  That was better.  The driver climbed on in
front of her.

"Hold on to him for dear life!"  Lexy yelled.  "I'll run!  Catch up to
you at the hospital!"

"What about the limo?"

"The hell with it!"

Anne clutched the driver's shoulders from behind.  He kicked the
machine into gear and they started off, weaving unsteadily through the
narrow spaces between the lines of stalled vehicles.

Lexy trotted along in front of them, praying to herself that this was
all going to work out somehow.

Between the gridlock of cars and the crush of pedestrians out on the
street, the motorcycle did little better than a fast crawl.

They covered the ten blocks to the hospital in about fifteen minutes.

Lexy, her adrenaline pumping furiously, kept getting ahead of them and
then backtracking to urge them on.

Lexy ran into the hospital first, commandeered an orderly and a
wheelchair, and dashed back outside just as Anne and the motorcycle
were pulling up to the front entrance.

They transferred Anne into the chair and the orderly wheeled her
inside.  Lexy turned to look for the Good Samaritan with the
motorcycle.  He was already coasting down the drive, revving the
throttle on the handlebars.

"Hey!"  she yelled.  "Come back here!  I owe you a hundred bucks!"

He waved a hand, kicked the machine into gear, and wheeled off into the
din of people and traffic.  I Lexy jogged back into the hospital.  Anne
was sitting in the wheelchair just inside the lobby entrance.

"Where'd the orderly go?"  Lexy demanded.

"He wants to take me up to the maternity ward.  I told him to call Dr.
Goth first."

"Fuck Dr.  Goth--we're getting you to maternity right away!"

Lexy wheeled Anne off in the direction of the elevator bank.

From his chair in the hospital's main waiting room, Joseph Cooper had a
narrow view of the shallow foyer and the locked door at the end of it
that led into Goth's new wing.  He had been sitting there, on and off,
for five hours, waiting for Goth to leave.

Suddenly the door opened and Goth came hurrying out.

Thank God.  Finally.

Cooper waited until Goth was in the lobby; then he stood up and walked
quickly to the door.  He punched in a five-digit number in the
electronic keypad on the door frame and pushed the door open.  He had
learned the combination by videotaping Goth and his assistants punching
in the numbers over a period of several days.

The lights were on.  Goth was coming back.  Shit.  He'd have to
hurry.

Cooper trotted down the corridor to the laboratory and began looking
around.  He knew that Goth kept a copy--maybe the only copy--of the
program in an attache case that he always carried with him when he
arrived and departed each day.

He spotted the case sitting next to a computer on a counter top.  He
opened it.  No cartridge disk inside.  He looked at the computer.  It
was on.  The screen was filled with data.

He saw the RCD plugged into its bay in the front of the computer.  He
turned the machine off and was about to extract the disk when he heard
voices.  He ducked into a small lavatory off the lab and shut the
door.

Before Lexy and Anne reached the elevator bank Goth appeared, a
sticklike figure in a lab jacket with a fringe of gray hair trotting
toward them, waving his arms wildly over his head.  "Over here!"  he
yelled.

He took over the wheelchair from Lexy and wheeled Anne down the hall at
a fast trot.  Lexy ran behind him.  Hospital ctfffrc Ctf f. wtfhinl:r
the frntif nrffeccif,n with hemused

Goth led them into the locked wing of the hospital that housed his lab
and clinic.

"This isn't the maternity ward," Lexy objected, as they raced down the
clinic's deserted corridor.

"We have a special room for her," Goth explained.  "Right in here."

Halfway down the corridor Goth stopped, opened a door, flicked on a
light, and wheeled Anne inside.  The room was large and decorated like
a bedroom.

"Get her comfortable," Goth directed.  "I'll summon the
obstetrician."

He darted across the hall and into his laboratory office.

Lexy helped Anne get undressed and into the bed.  "What's happening?

Any labor yet?"  I Anne took a deep breath and uttered a low groan.

"Getting some pain now."  I "Jesus, we just made it.  Do your breathing
exercises."

Anne started exhaling short puffs of air.  I Lexy squeezed her hand.

"Christ, how can you be so calm?  I'm twice as nervous as you are."

Anne managed a wan smile.  "We have to try Dalton again.  The number's
in my bag."

Lexy fished through Anne's purse and dug out an address book.

"Where'd you list it?  Despres?  Dictator?  Despot?  What?"

"National Palace."

"Of course."  Lexy found the number, grabbed the bedside phone, and
dialed.  "It's ringing, but nobody's answering."  She glanced up at the
wall clock: 11:30.  "Everybody there'll be drunk."  She redialed but
still got no answer.  "I'll try again in a few minutes.  Maybe the
clerk at the hotel already got him and he's on his way."

Anne's labor pains became more frequent and intense.  "I can feel her
moving, Lexy!"

Lexy gritted her teeth in anguish.  "Oh my God.  Hold her in there,
Annie.  The cavalry is on the way."

Goth reappeared with a nurse--a thin, elderly black woman.

She introduced herself as Katherine and immediately took charge, taking
Anne's blood pressure and taping a fetal heart monitor onto her
belly.

"Where's an obstetrician?"  Lexy demanded.

Goth looked pained.  "They're trying to find him."

"Him?  There's only one?"

"One on duty tonight, yes.  The switchboard is paging him.  If
necessary, I can do the delivery."

Lexy scowled at him.  "Sure, and so can a cab driver, if he has to.

What do you know about it?"

Goth straightened up, offended.  "I've delivered dozens of infants.

There's absolutely nothing to worry about."

Katherine mopped Anne's brow with a damp cloth.  "How's the pain,
honey?"  she asked.

"Getting up there," Anne whispered.  She was breathing rapidly.

The nurse gave Anne a shot of painkiller, then positioned herself
between her thighs and examined her.  "Fully dilated," she declared in
an authoritative voice.

Goth nodded nervously and wiped his glasses.

"What's that mean?"  Lexy demanded.

Goth pressed Anne's belly with his hands.  "Baby's on the way.

She's in a good position.  Half an hour.  Maybe less."

"Start pushing, honey," the nurse said.

Katherine and Lexy held Anne's hands and helped her time her pushes.

Goth scurried frantically between the room and the adjacent lab to make
sure he had in place everything he needed for the birth.  Despite his
assurances that he knew what he was doing, his obvious anxiety
frightened Lexy.  She watched him place a call to the hospital
switchboard and once again demand the whereabouts of the
obstetrician.

Told they had yet to locate him, Goth cursed and slammed down the
phone.

Anne, meanwhile, was too preoccupied with her labor to pay much
attention to what was going on around her.

Lexy tried another call to the National Palace, and this time someone
answered.

"I need to find Mr. Dalton Stewart!"  she shouted.  "It's an
emergency.  His wife's having her baby!  He's there, at the party.

Please find him at once!"

The voice at the other end answered in French and then hung up.  Lexy
dialed the number again.  The same voice answered.

"Il faut que je trouve Monsieur Dalton Stewart, immediatement!"  she
stammered loudly, in halting high-school French.  "Je sais qu'il est
la.  Voulez-vous le trouver pour moi, s'il vous platt?

C'est tres urgent."

The voice muttered something incomprehensible and put the phone down.

Lexy waited for several minutes, watching with mounting panic as Anne
began writhing and groaning again.

"Push, honey!"  Katherine cried.  "She's coming down.  Push!

Push!  That's it!"

Goth kept checking the fetal monitor and talking to himself.

Lexy had never seen a doctor so nervous.  It suddenly crossed her mind
that he might be worrying that Anne was going to need an operation.

Clearly he wasn't going to be able to handle that.  Judging from the
nurse's confident coaching, Anne seemed to be doing fine.  But Lexy had
never seen anyone give birth before, so she really didn't know what to
think.

Goth discovered he needed something.  He ordered the nurse to rush over
to the maternity ward and fetch whatever it was.

Katherine hesitated.  She glanced at her wristwatch.  "Spasms are only
fifteen seconds apart."

"Then hurry up!"  Goth shouted.

Lexy hung up the phone and came over beside Anne.  "Go ahead," she
said.  "I'll take over."

Katherine hurried out the door and down the corridor.

Lexy dried Anne's brow with a towel.  Anne had her eyes closed tight.

She was clenching her jaw.

"You okay, Annie?"

"It hurts like hell," she gasped.

Goth slipped on a pair of latex gloves and probed Anne's vagina with
his fingers.

Lexy watched his face.  Strange, she thought: here he was about to
deliver her baby, and he never seemed to look at or talk to Anne
directly.  He acted almost embarrassed to be there.

I

Goth nodded to reassure himself.  "Crown's engaged," he said.

"Just right.  Shouldn't be long now."

A sharp series of spasms made Anne wail with pain.  Lexy held Anne's
hand and coached her to push.  Anne cried louder.

The cry seemed to echo down the corridor.  Lexy looked at Anne.  Her
eyes were shut and she was panting.  Another cry came from the same
direction.  It sounded like the nurse, Katherine.

Goth stepped over to the doorway to look out.  No sooner had he stuck
his head through than he pulled it back inside.  He stood inside the
doorway for a few moments, as if debating with himself what to do.

Lexy glanced over.  "What is it?"

Goth didn't reply.  He seemed frozen in place, unable to move or
think.

Lexy heard voices in the hallway.  "What is it?"  she repeated.

Goth pushed the door shut.  He fumbled with the knob for a few seconds,
searching in vain for a way to lock it.  "There's trouble," he said.

He reached for the light switch.  The room went dark.  "Call the
police.  Hurry."  His voice was quaking.

"Police?  What's wrong?"

"Just call them!"  he commanded.  "And for godsakes protect the
baby!"

The doctor hesitated by the door for a few seconds more, then opened it
and vanished down the corridor.

The baroness was wearing high heels, and she caught her step slightly
on the terrace stone as she walked toward Stewart.  She appeared a
little drunk.  Some of the champagne in her glass spilled.  He could
smell her perfume: subtle, yet potent--like violets with a trace of
something faintly pungent underneath.

"How is your darling little wife?"  she asked, leaning close to him.

"Not so little these days."

"Of course.  She's having a baby soon, ja?"

"About a week."

"You must be very excited about it."

Stewart nodded.

The baroness fastened her eyes on him.  When she talked, especially
when she wanted to command someone's attention, she tended to stare.

The tactic invariably unnerved people.  Stewart stared back.  Except
for the Seguridad men who paced the perimeters of the lawns beyond,
they were alone on the terrace, standing barely two feet apart.

The baroness smiled suggestively.  "We have a lot in common, the two of
us.  Don't you think so?"

"I've never really thought of it."

"Haven't you?"

"No.  Should I have?"

"I think I have been in your thoughts from time to time, Herr
Stewart.

May I call you Dalton?"

Stewart felt his face grow warm.

The baroness laughed.  "I'm making you uncomfortable.  I apologize."

She perched on the wide terrace parapet and patted the space beside
her.  Obediently, Stewart sat down.

"I'm surprised to see you here," he said.

"Are you?"

"There must be some wonderful parties in Europe tonight."

"But the Caribbean is so lovely in the winter.  Look at tonight.

So beautiful.  So mild.  Quite romantic, don't you think?"

"I guess it is.  Yes."

"Oh, and I must congratulate you."

"On what?"

"Why, what do you think?  Winning Dr.  Goth and his Jupiter program."

"That's generous of you."

"I'm not accustomed to being outmaneuvered.  I confess you outsmarted
me."

Stewart tasted his scotch.  Her compliments seemed out of character.

The baroness became thoughtful.  She pressed the edge of her champagne
glass against her cheek.  "But you've made some mistakes, ja?"

"Have I?"

"You failed to tie up Herr Dr.  Goth with a contract, for one thing."

"That wasn't a mistake.  It was part of the plan.  After all, he turned
your offer down and accepted mine."

"But you had no offer.  You just gave him money.  What kind of
arrangement is that?"

He laughed.  "A pretty good one, as it turns out."

"But you're taking too much risk."

"Not at all.  As soon as Goth demonstrates that Jupiter works, we'll
negotiate a contract.  And we'll get much better terms, because Goth
knows I've already contributed to his success.  He's indebted to me."

Stewart wanted to brag about how he had also persuaded Goth to put his
program to the test by trying it out on Anne, but he thought better of
it.

They gazed across the terrace at the party inside.  The French doors
had been opened to let in cooler air, and the noise inside was at a
temporary lull, as if the crowd was catching its collective breath
before the last mad dash to midnight.

"I could have made trouble for you, you know," the baroness said.

"Oh?"

She ran a fingernail teasingly along the back of Stewart's hand.

"President Antoine Despres and I are very close friends."

"I'm not sure that's something to boast about."

The baroness laughed.  "What I mean, of course, is that I have
influence with him."

"I see."

"Certainly enough to keep him from causing you trouble."

"He's been no trouble at all."

"But eventually he might be."

"That's occurred to me."

"You should take me on as your partner.  There could be great virtues
in our working together."

Was she serious?  He couldn't tell.  "Do you think so?"

"Of course.  We'd complement each other perfectly.  And with my help
you could get rid of Despres.  I know a much less greedy individual
who'd be very much in our debt if we helped him with a coup."

Stewart glanced around anxiously at the guards patrolling the lawn.

The baroness was talking in a fairly loud voice.

"And let's face it, Dalton--you need more money and more trained
personnel to put into this project.  And I have both.  Things would
move much faster.  Together we'd be able to command a world market for
Jupiter."

"I'll certainly think about it," he replied.  But he certainly didn't
intend to do anything about it.  Taking on.the baroness as a business
partner would be like inviting in the Mafia.

"There should be enough money for both of us, don't you think?"

"I don't know.  I'm pretty greedy."

The baroness laughed.  "So am I, Liebchen."

Jupiter s L)aughter ù l

"How much profit do you think there'd be?"  he asked.  He was curious
to know how seriously she had thought through the possibilities .

"I estimate five hundred million dollars in five years.  In ten years,
thirty billion.  Perhaps even fifty billion."

It was Stewart's turn to laugh.

"Why is that so funny?"

"Your estimates are modest, Baroness."

"Are they?"

"I expect to make that much in the first two or three years.  In ten
years, I'll gross a trillion."

The baroness's flirtatious manner evaporated.  "What did you say?  A
trillion?"

"Yes."

"Dollars?  " "Dollars."

She rotated the stem of her champagne glass thoughtfully between her
thumb and forefinger.  "How much is a trillion?"  she asked.  "A
thousand billions?"

"That's right."

The baroness looked out across the dark Caribbean sea.  She took a deep
breath.  Stewart watched appreciatively as her breasts heaved under the
thin material of her gown.

"No one's ever made so much money, have they?"  she said.

"No one's ever had anything to sell like Jupiter."

"You don't worry that it's unproven?"

"No.  I don't worry about it," he replied.  Of course he worried about
it constantly.  But soon he'd know.

She regarded him intently.  "That's the risk you take, isn't it?"  she
said.  "If you want to be first, I mean."

Stewart sipped his scotch.  The ice in it had melted, and it tasted
watery.  "That's the risk."

The baroness had recovered her cozy manner.  She squeezed his hand
suggestively.  It set his pulse racing.  "You see how much we think
alike?"  she said.  "We both enjoy taking risks.  That's when we feel
most alive, ja?"

He nodded.  Ja.

She moved her hand to his thigh.  "I feel very alive right now," she
whispered.

Anne raised her head from the pillows.  "What's happening?  Why are the
lights off?"

"Some people out in the hall," Lexy whispered.  She tried to keep the
fear out of her voice.  "Probably a New Year's party.

The doctor's talking to them."

They could hear Goth shouting in the corridor.  Someone answered him.

Lexy couldn't catch the words.  Then Goth's voice grew quiet.

Lexy groped in the dark for the telephone.  She tried to dial the
operator, but her hands were trembling so hard she kept hitting the
wrong button.  The hospital switchboard answered on the seventh ring.

"Get the police," Lexy said in a harsh whisper.  "We're in the new
wing.  Someone's breaking in!"

The operator made her repeat the request three times, then laughed at
her.  "They'll all be drunk tonight, baby!"

Lexy raised her voice.  "Goddamnit, call them!  Quick!"

She put the phone down and tiptoed to the door.  A sheet of paper taped
over the small window stopped about an inch short of the bottom.  Lexy
bent down and peered out.  She could see a short stretch of corridor.

Directly across it was the open door into Goth's laboratory.  The
doctor was in there.  Three other men were with him.  One held Goth's
arms pinned behind his back; another was poking a pistol against his
chest.  The third male was pulling what looked like blocks of clay from
an overnight bag and sticking something into them.  He prepared about a
dozen blocks in this manner, then began attaching them to various
surfaces around the room--to the underside of a counter holding a lot
of expensive-looking computer equipment, beneath a sink, under a large
wall of shelves stocked with boxes, books, and lab equipment.  Plastic
explosives?

Lexy groped her way back to the telephone and tried the switchboard
again.  The phone was dead.

She looked down at Anne.  The thin rectangle of light shining though
the door's small window fell across her face.  Her eyes were closed.

She was resting between spasms.  In another minute she would be
thrashing and groaning again.  The baby could come out with the next
big push.  Jesus, Mary, and Joseph, what a nightmare.

Lexy rushed to the window.  She could still see Goth and the two men
guarding him.  They were arguing.  The third man suddenly appeared in
the corridor.  He opened the door to the room next to the lab and
looked in.  Then he went to the next door down and Lexy lost sight of
him.

Lexy felt around for something to block the door.  She found a metal
chair and wedged it under the doorknob.  Then she slid two other chairs
and a large chest of drawers behind the chair.  The tile floor had
recently been waxed.  A good hard shove from the other side of the door
would likely push everything right back across the floor.

Anne started to moan.  She clutched Lexy's hand and writhed on the bed,
pulling her knees up to try to ease the pain.

Lexy tried to quiet her.  She wiped Anne's brow with a damp cloth.

Where the hell are the police?  Why don't they get here?  Oh God, why
don't they get here?  "Hold on, Annie.  It's going to be okay."  She
wished she could believe it.

The doorknob rattled.  Voices in the corridor grew louder.  Lexy could
see the silhouettes of two heads through the glass.  They began pushing
hard against the door.  The chairs and the chest squeaked backward
along the tile floor, and a vertical wedge of light from the hallway
appeared along the edge of the door frame.

The wedge widened.  Someone squeezed partway in, then braced himself
against the doorjamb and shoved the furniture back several feet.  He
groped for the light switch.  The overhead fluorescents blinked on.

It was the man with the gun--the one who had been questioning Goth.  He
walked into the room, then hesitated, confused by the sight of Anne and
Lexy.  He said something to them in German.

Anne opened her eyes and groaned.

The man stepped over.  Lexy bent protectively over Anne.  "Get out of
here!"  Lexy cried.  "I've called the police!"

He pressed the pistol against the side of Lexy's head.  "Who are
you?"

he demanded.

Lexy began trembling violently.  "Get the hell out!"

A loud pounding at the far end of the corridor interrupted them.

Someone yelled "Polizei!"  several times.

The man took one last look at Anne and Lexy and then ran out into the
corridor.  Frantic shouts greeted him.  Through the open doorway Lexy
saw him drop to his stomach and train his pistol down the corridor and
open fire.  Magnified by the long cement-block corridor walls, the
shots sounded like exploding grenades.  They were answered by a
deafening burst of automatic weapons fire.

The walls vibrated from the racket.  Cement dust choked the air.  The
man on the floor tried to stand up.  Blood ran from his mouth and
ears.

More gunfire.  He jerked backward, as if caught by a sudden gust of
wind, then leaned forward, his arms flung out in front of his chest in
a vain effort to ward off the fusillade of bullets tearing through
him.

He sank down face-first onto the floor.

Lexy lunged against the door to close it.  A ricocheting bullet struck
her near the shoulder, spun her around, and knocked her down.  Her left
arm felt numb.  She crawled to the door and managed to get it shut,
then struggled over to Anne's bed.

Wild shouting in the halls.  Something exploded.  The blast blew the
door in on a cloud of stinking gray powder.  More shouting, and the
frantic pounding of boots on the tile floor.

Through the ringing in her head Lexy heard Anne screaming.

She sounded faraway.  She tried to pull herself onto the bed to protect
her.  She lacked the strength.

She felt dizzy.  The room was growing dark.  She tried to raise her
head up but couldn't.  She blacked out, came to for an instant, then
blacked out again.

When she surfaced a second time, the dust in the room had settled
somewhat.  Her blouse was wet with blood.  Anne's screams had faded to
a continuous moaning.

A man was coming toward her.  She tried to yell for help, but all she
could manage was a hoarse shriek.  There was no one to help them,
anyway.  She tried again to pull herself onto the bed.

God, please help us.  Somebody please help us.

The noise from inside was growing louder.  Several of the French doors
were open, and partygoers were spilling out onto the terrace.  The
atmosphere of civilized restraint from earlier in the evening had
completely vanished, washed away by the free-flowing alcohol.  Guests
were yelling or singing in loud voices.  Others were dancing lewdly,
embracing, rubbing against one another.  Many were too drunk to
stand.

Stewart could see a young male lying prone on the floor just inside one
of the French doors.  Apparently he had passed out, but there was a
small pool of blood by his mouth.  People were stepping over him as
they walked through the doorway.

Stewart felt the baroness's hand traveling along the inside of his
thigh.

"We should do something to celebrate," she said.

"Kissing is traditional," he replied.  He slipped an arm around her
shoulder and kissed her.  The moist, warm softness of her lips, the
mixture of champagne and perfume aroused him powerfully.

She pushed him away gently.  "Kissing hardly seems enough to welcome in
a whole new millennium," she cooed.

Waves of cheering and applause thundered out from the main ballroom.

The countdown of the last minute of the old year had started.

A sudden shock of cold wetness in the crotch made Stewart jump.  He
looked down.  The baroness had spilled champagne on his pants.

She giggled.  "I'm really very sorry."  She rubbed her hand against the
wet area.  His penis became instantly rigid.  She pulled his hand up
under her dress.  "Take my underpants down," she instructed.  "Hurry.

" He reached up along her thighs with both hands and pulled her panties
down over her knees.  She braced herself against his shoulder and
stepped out of them.  They were white silk, with a broad trimming of
lace, and they reeked of that same intoxicating perfume.

She lifted her gown up to her waist, leaned back against the stone
parapet, and opened her legs.  He moved between them and they kissed
again, this time with an angry passion.

The baroness clutched Stewart's head between her hands and pushed him
down.  He knelt awkwardly on one knee.  She entwined her fingers in his
hair and pressed his face into her belly.

A church bell in town began to chime midnight.  Seconds later, another
church bell began.  And then a frenzied roar came from inside the
palace and grew in volume until the terrace began to shake.

Dalton Stewart, his ears squeezed firmly between the baroness's thighs,
could hear nothing except the wild beating of his heart.

The man coming through the door was black.  Lexy had not seen him with
the other men around Goth.  "Please tell me you're the police," she
groaned.

"What are you doing here?"  he demanded.

Lexy bent over Anne.  "She's trying to have a baby."

"You have to get her out of here.  Right now.  Come on."

Cooper got behind Anne's bed and began pushing her toward the door.  On
its big castors the bed rolled easily.  Lexy followed, cradling her
wounded arm.  The hallway was choked with dust, but deserted.  A shot
rang out from somewhere in the building.

Lexy crouched forward and ran.

A short distance down the corridor Cooper steered the bed around a
corner toward an emergency exit.  He yanked the door open, but the bed
was too wide to fit through.

Lexy stumbled.  She felt on the verge of passing out.  She watched the
black man lift Anne up out of the bed.  It looked as if both of them
were about to fall over.  Another burst of gunfire rattled through the
corridors.  What in God's name were they shooting at?  she wondered.

Were they mad?  She moved to Anne's other side.  Anne managed to stand,
but she was bending far forward to relieve her pain.  Slowly, they
maneuvered her through the door.

It was completely dark outside.  They were somewhere around the back of
the hospital.  Lexy felt soft grass underneath.  They walked Anne a
short distance further and then lay her down on a sheet on top of the
grass.  Cooper positioned her on her back and propped her knees up.

Between sobs, Anne panted noisily for air.

Lexy wanted to do something to comfort her, but she felt too weak to
move.  She knelt down beside her and held her hand.

"You know what to do?"  Cooper asked.

Lexy shook her head.  "No, goddamnit!  Go get us help!"

The ground suddenly heaved beneath them as if from an earthquake.  A
row of windows in the hospital wing blew out in a bright flash, then
subsided into curling billows of black smoke.

Cooper jerked his head around and swore under his breath.

Without another word he scrambled to his feet and headed back toward
the exit door they had just come through.  Another explosion blew out
more windows.

Anne arched her back and screamed.

Harold Goth struggled to his feet.  A thick, stinking pall of smoke
hung in the air.

He thought about putting a water-soaked cloth over his mouth and nose,
but knew he didn't have time.  He dropped to his hands and knees.

There was less smoke near the floor, but he was already choking from
the acrid fumes.

He crawled toward his computer on the workbench along the far wall.

When he got there, he reached up for the program cartridge and tried to
pull it out.  The plastic was scorching hot.  He snatched his hand back
and forced his face up closer to the computer.  He rubbed his eyes.

The machine's plastic housing had been destroyed by the explosion.  The
cartridge disk was fused to the computer's frame.

The smoke was beginning to suffocate him, and it was getting intensely
hot.  Goth lay close to the floor, coughed, sucked in a rasping breath,
and then struggled to his feet and dashed toward the filing cabinet in
the closet next to the lab's lavatory.  The cabinet contained the only
backup copy of the Jupiter program.

He reached the cabinet, grabbed the handle of the top drawer, and
tugged.  It was locked.  He jerked hard on the drawer, but it refused
to budge.  The key was in his attache case.

Goth dropped back to the floor and began searching for the case.  He
was certain he had left it by his desk, but he didn't see it there.  He
crawled along in front of the workbench, looking around the floor.  It
was nowhere in sight.  He began to panic.

Then he saw it, wedged in a shelf under the bench.  He pulled it out.

A hand reached swiftly around from behind him and grabbed the attache
case by the handle.  Goth wrapped both arms around it and held on.  The
two men struggled for a few seconds.  Then Cooper punched Goth once
hard in the face and yanked the case free.  He disappeared with it
through the smoke.

Goth rose from the floor, choking and coughing, and staggered back
toward the file cabinet.  He pulled at the cabinet drawer in one last
desperate effort to open it.  The whole cabinet fell forward and
pitched over on its side.  Goth sank to his knees, his hand still
clutching the top drawer pull.  His eyes were watering so fiercely he
couldn't see.  His nostrils and his mouth were stinging with pain.  He
couldn't catch his breath.

Another charge exploded.  This one had been set under a shelf full of
chemicals just behind Goth's back.  The blast shattered the jars and
sent liquid chemicals spurting in every direction.

In an instant Goth was bathed in burning liquid.  He slid face down
against the floor, his hand still clutching the file cabinet handle.

Cooper rushed out the emergency exit, ran over to a lighted window near
where the wing joined the main part of the hospital, and yanked open
the attache case.

There were papers in it, and a key, but no cartridge disk.  He threw
the case onto the grass and kicked it.  He looked at the wing.  There
was no going back.  The whole place was ablaze.

Lexy crawled over between Anne's legs.  She reached toward Anne's belly
and in the dark felt a hard, round, slippery object.

Oh God, she thought.  Where's Goth?  "Push, Anne," she whispered.

"Push."

Anne cried out again--a long, anguished moan, directed skyward.  Lexy
felt the baby come squirming out into her hands.  Dr. Goth, where the
hell are you?

There was a tremendous wave of noise.  It was deep and allencompassing,
like the noise of a crowd at a college football rally--the honking of
horns and the deep-throated cheering of a hundred thousand voices.

Midnight.

Overhead the black sky blossomed with fireworks.  Bright flowers of
blue, red, silver, and green exploded with concussive booms and
rippling crackles, lighting the patch of lawn around them as brightly
as day.

The baby cried lustily.

Lexy held the infant against her.  She saw the umbilical cord.  It was
wrapped around the baby's leg.  She pulled it free, then glanced toward
the hospital wing.  It was engulfed in flame.  Goth was never coming.

She held the baby close to her, took a deep breath, put the cord in her
mouth, closed her eyes, and bit down hard.

Once she had severed the cord, Lexy tried to tie it off, but it was so
slippery and her left arm was so weak she couldn't hold it.  She pulled
off her blouse and used it to get a better grip.  Finally she managed
to knot the cord tightly against the baby's stomach.

She wrapped the blouse carefully around the infant and held it close.

Anne was sobbing convulsively from pain and exhaustion.

Lexy bent over her, cradling the child.  "You did it, Annie!"  she
cried, suddenly overcome with tears herself.

In the flashes of the fireworks thundering overhead Lexy raised the
tiny, blood-flecked creature up toward the heavens in a gesture of
gratitude and celebration, then placed her in Anne's arms.

19

Anne Stewart patted the space beside her on the piano bench.

"Come, darling, sit here with me."

The little girl toddled over to the piano, and Anne reached down and
lifted her onto the seat.  Genny settled her hands into her lap and
gazed up at her mother with an expectant smile.

Genevieve Alexandra Stewart seemed the perfect child.  She was bright,
attentive, well-behaved, and as beautiful as Anne could possibly have
expected.  Her curly blond locks, button nose, luminous slate-blue
eyes, and dimpled chin instantly beguiled everyone who met her.

For a twelve-month-old, her manner was extraordinary.  She moved with
the grace, strength, and sense of balance of a much older child.  And
she had a way of looking at someone that was completely captivating.

Her intense eyes would focus on a person's face with an inquiring gaze
that seemed to penetrate right through to some inner place with which
the child could communicate.  Some people found this unnerving.  Lexy
Tate, for one: she had already taken to calling Genny "Little Devil's
Eyes"--a nickname that Anne did not find amusing.

During the first months of her life, Genny had cried a great deal.

Mrs. Callahan, her nanny, thought the reason for the little girl's
irritability was an abnormal sensitivity to touch.  Anne sometimes
wondered if it had something to do with the traumatic circumstances of
her birth.

Now Genny rarely cried at all.

1 6 9

But she did exhibit some odd moods.  Anne would sometimes walk in on
her to find the child staring with rapt concentration at some object or
other.  Often she seemed to be looking at nothing but empty space.

Watching Genny during one of these periods of intense, trancelike
fixations, noticing how she sometimes tilted her head to one side or
crinkled her nose, Anne had the extraordinary impression that Genny was
imagining something--seeing, hearing, or even smelling something--that
wasn't there.  Anne had reported these peculiar states to Genny's
pediatrician, but the doctor had dismissed them as being of no
consequence.

Anne ran a hand over Genny's curls.  "What would you like to hear,
darling?"

"Star," Genny exclaimed in a bright voice.

Anne played through the melody of "Twinkle, Twinkle, Little Star" with
her right hand.  Genny listened with a solemn expresslon.

After a few repetitions Anne stopped.  She brushed a vagrant wisp of
hair away from Genny's forehead.  "Would you like to hear a song about
another star?"

Genny nodded her head emphatically.

Anne quickly searched out the melody for "When You Wish Upon a Star,"
added the appropriate chords, and then played the song, singing the
words in a soft voice.

Genny's eyes followed her mother's fingers with rapt attention as they
moved over the keys.  Her face beamed with pleasure.

Anne was especially pleased with Genny's response to the piano, because
there had been a period, only a few months back, when she feared that
something might be wrong with Genny's hearing.  The little girl seemed
to wince at the slightest sound, and she still did not tolerate loud
noises well.

"Do you like that song?"

Genny nodded.

"It's from a story called Pinocchio.  It's about a little puppet, made
out of wood, who wants more than anything in the world to become a real
boy."

"Pin-noke-ee-o," the girl repeated, pronouncing the word perfectly.

Genny was undeniably precocious.  By eight months she had begun to
walk, and by ten months she had said her first word.

Anne remembered the moment vividly, because that first word was three
syllables long.  It happened one afternoon in early November.  Anne
walked into her room to wake Genny from a nap.

The child was already standing in her crib, waiting, her little hands
impatiently clutching the rail.  She giggled and then said something.

It sounded like "Toronto."  Anne thought she had imagined it, but Genny
repeated the word, uttering the sound with an unmistakable clarity.

Anne lifted her into her arms, shrieking with astonishment and
delight.

There was no mistaking it.  Her little baby had actually said the word
"Toronto."  It was both funny and miraculous.

Anne remembered that Dalton had come into the nursery the day before.

He had held Genny in his arms and talked to Anne about going to Toronto
on a business trip.  But of all the words to pick, thought Anne.  Genny
repeated "Toronto" a few more times that day and then promptly forgot
it.

But "Toronto" had opened the gates.  In the days that followed, new
words poured forth from the little girl at the rate of three or four a
day.  Now, at twelve months--an age when most children had barely
uttered more than a "Mama" or "Dada"--Genny's active vocabulary was
well over a hundred words, and she was beginning to put them together
into two- and three-word sentences.

Anne was still surprised--even a little frightened--by the strength of
her own feelings for her child.  Of course she had expected to love her
without reserve, but she had never been able to imagine the depth and
the intensity of the emotions this infant would stir within her.  She
understood now the truth of all those old cliches about mother love.

She knew, without a second's doubt, that nothing else would ever mean
as much to her in her life as this unique and precious, vulnerable
creature, so full of needs and wants and demands.  Nothing else in the
world could possibly ever evoke such an all-consuming protective
passion.

Anne embraced the demands of motherhood with enthusiasm and joy.  But
just as she knew that Genny would enrich her own life immensely, so she
also understood that she would never be able to separate herself
emotionally from her daughter's fate.

Whatever happened to Genny would, in effect, happen to Anne as well.

She supposed this was what all parents felt, to a greater or lesser
degree; but it came to her as a shock to discover that with the
happiness there would forever be an undercurrent of anxiety, because
she knew as sure as she drew breath that if anything bad should ever
befall this child--if she should ever lose hen-the pain would be more
than she could bear.

Genny's arrival had worked an even more profound transformation on
Anne's husband.

Immediately after Genny's birth Dalton fell into a severe depression.

The cause was clear: Goth's death and the loss of the greatest
financial opportunity of Dalton's life.  After a couple of months, his
gloom began to lift.  He turned his attention to his new daughter and
soon became an even more anxious parent than Anne.  He seemed obsessed
with the fear that Genny might not be developing properly.  Although
the child had been subjected to a heavy battery of tests during the
first weeks after her birth, Dalton wanted more tests done--especially
after she began exhibiting her trancelike moods.  Over Anne's
objections, he took Genny several times to special clinics in New York
and Boston for further testing.  Although absolutely nothing negative
turned up, his anxieties remained.  For a long time he clung to the
conviction that Genny should be doing better, even though every book
and every expert consulted suggested that her development was at the
very least superior, if not extraordinary.

Then, for reasons Anne could only guess at, his worries about Genny
vanished.  He became the epitome of the proud and doting daddy.

One night after they had returned from a dinner party, he came out of
Genny's room with tears in his eyes.

Anne looked at him in alarm.  "Is Genny okay?"

He nodded.

"What's the matter?"

"I just .  . . realized something."

"What?"

"How much I love that child."

Anne laughed.  "Does it really surprise you?"

Dalton seemed to be struggling with his emotions.  "Yes.  I've never
had these feelings.  I've just never loved
anything--anybody--unconditionally."

"Does that bother you?"

"No.  But I guess I've always been afraid of the idea.  It takes .  .

.

I'm just not used to it, I guess."

They went into their bedroom and began to undress.

Dalton quickly recovered himself and laughed.  "Too much to drink," he
said.  "Makes me maudlin."

"Maybe you ought to drink too much more often," Anne replied.

Suddenly Dalton dropped onto the bed.  He looked stricken, as if
overcome by some terrible realization.  Anne sat beside him and put an
arm around him.  "Christ, what an ass I've been," he whispered, his
voice choking.

"About what?"

He buried his face in his hands.  "About you, about Genny.

About everything."

Anne hugged him.

"I've been such a goddamned selfish fool all my life, Anne.  And
somehow I've never even noticed.  I'm really sorry...."

They both cried.  He put his arms around Anne and they held each other
for a long time.

From that night on, Dalton Stewart began making a genuine effort to be
a good father and a loving husband.  He agreed with Anne that it was
essential that their child grow up in a happy and secure home, and he
promised to do everything possible to repair the damages in their
marriage.  Their relationship became stronger than it had ever been.

Dalton neglected his work to spend hours every day playing with Genny,
or just watching her.  Everything the infant did-every move, sound, or
facial expression--got his complete attention.  He read all the books
on child development and urged Anne to do the same.  He was eager to
know precisely what to expect at each stage of development.  All their
discussions centered around the baby and how she was doing.  Every
cough, burp, sneeze, or cry would send Dalton scurrying to consult a
book or to call the pediatrician.  The doctor, who had an office nearby
in Great Neck, was Dalton's choice, not Anne's.  She had wanted Paul
Elder, the pediatrician she had visited in Manhattan before Genny was
born.  But since he had rebuffed her so rudely, she had accepted
Dalton's choice without complaint.

They hired a nurse-governess also: Mrs. Denise Callahan.  She was a
middle-aged woman with impeccable credentials--she had been a nanny for
one of the Rockefeller families for fourteen years.  She was a stiff,
rather formal person, and Anne didn't relate to her terribly well, but
she had many virtues: she was steady, efficient, hardworking,
knowledgeable, and completely reliable.

And she was good with Genny.  She didn't especially fuss over her, but
neither did she ever show impatience or anger.

Although now Dalton was once more heavily immersed in his business
activities, he still checked in on Genny's progress several times
daily.  If he was away on a trip, he always called at the end of the
day for a full report.

Every time Anne thought of the changes that Genny had wrought on her
mother and father in one short year, she felt moved to tears.  Not only
had the child brought great happiness into their lives; she had
actually made them better human beings.

"Would you like to play, too?  Here, give me your hand."

Anne took Genny's tiny hand in hers and brought it up to the eyboard.

She held the girl's middle and forefinger together and gently pressed
them on the G below middle C. Genny squealed with pleasure as the note
sounded.  Then up an octave they went, to the next G, then back to F,
then E, C-sharp, D, A; D, B, A, G, F-sharp, G, C, and so on, until they
had completed the song's melodic refrain.

Anne guided Genny's fingers through the melody a second time.

With her free left hand she added some chords.  Genny giggled with
barely suppressed excitement all through the exercise.

Anne hugged her hard.  Yesterday--the first day of the new year,
2001--had been Genny's first birthday.  Anne had arranged a small party
for her, attended only by Dalton, Hank Ajemian and his wife, Carol,
Lexy Tate, and the house staff.  Anne had tried to find a child Genny's
age somewhere nearby, but that part of Long Island's North Shore was
not a neighborhood of young families.

Lexy had stayed overnight, and she and Anne had both gotten a little
drunk, reminiscing about that fateful New Year's Eve on Coronado.

Lexy's gunshot wound was now a small round scar about the size of a
quarter, high on the outside of her left arm, just below the
shoulder.

She was very proud of it.  She wore short sleeves as much as possible,
just to show it off, and would regale anyone willing to listen with an
extremely detailed account of how she had received it.

Anne picked Genny up from the piano bench and carried her back into the
nursery.  Mrs.  Callahan was there, putting clean sheets on the crib.

Anne put Genny down.  The little girl scampered across to the enormous
pile of stuffed animals arranged on the window seat and began pulling
them down onto the floor and hugging them.

"Dalton and I are having an early dinner tonight, Mrs. Callahan.  He's
leaving for Washington early tomorrow.  I'll be back to nurse her at
eight."

Mrs. Callahan's expression became stern.  "Very well, Mrs. 
Stewart."

Anne smiled to herself.  Mrs. Callahan didn't believe in breast
feeding after six months, and she had made her position in the matter
quite clear.  Anne had listened to her advice politely and then ignored
it.  But now, with a year gone by, she knew it was time that she come
to some sort of decision.  Her head told her to begin weaning Genny,
but she was still reluctant to give it up.

Well, perhaps another month, and then she'd decide.

Dinner with Dalton was a strained affair.  The two of them sat at one
end of the enormous table in the mansion's forbiddingly ornate dining
room and talked aimless trivialities.  Dalton seemed tense and
preoccupied.

"Is something wrong?"  Anne asked.

Dalton shrugged, then nodded.  "Some business problems.

Things are a bit difficult right now."

"You can't elaborate?"

"What's the point?  You wouldn't understand."

"You promised me you weren't going to do this anymore, remember?  " "Do
what?"

"Shut me out of your world.  Maybe I would understand."

"I don't mean you can't understand.  I just mean it's all rather
complicated and boring to anyone on the outside."

Anne lifted her wineglass and looked at it.  "So I'm still someone on
the outside?"

"You know what I mean."

"I know that I've learned more from Hank Ajemian about the whole
industry of biological engineering in the few times he's been here to
dinner than I've learned from you in three years."

Dalton chuckled.  "Ajemian likes to talk.  Besides, he's got a thing
for you.  He likes to impress you."

Anne didn't reply.

Dalton sighed.  "Stewart Biotech is in trouble.  If we don't get some
cooperation from the banks in the next few weeks, we'll have to go into
Chapter 11."

"What's that?"

"We'll have to get protection from our creditors until we can
reorganize."

"Bankruptcy ?  " "Does that shock you?"

"Well, yes.  Shouldn't it?  I haven't had a clue from you that things
were so bad."

Dalton stared at the big silver candelabra in the center of the
table.

"Although from what I've heard, businesses do it all the time," Anne
continued.  "And go right on as if nothing had happened."

"It's serious, just the same.  The banks would take control.  And we
could eventually lose the company."

"Why have things deteriorated so?  Didn't you tell me that last year
the company had the best year in its history?"

"It did.  But it's complicated.  We got overextended, and the economy
turned sour, all in the same year.  And we lost a lot of money in
Coronado."

"How?"

"How do you think?  We made a big investment in Goth.  When the wing of
that damned hospital burned down, everything went with it--Harold Goth,
his research, his papers, his files, his computer disks--everything we
had counted on to make back our investment.  And we didn't have a
dime's worth of insurance.  Nobody would cover us."

"What was it that he had discovered?  Why was it all such a big
secret?"

Stewart looked faintly embarrassed.  "We were afraid of competition.

Goth had developed a gene therapy that could have been enormously
profitable.  At least that's what we thought at the time.  Now, we'll
probably never know."

Anne sensed her husband was avoiding something.  "What exactly was this
program of his supposed to do, anyway?  You never really explained it
to me."

"I'm not sure I understand it myself."

"I find that hard to believe."

"It had to do with a complicated series of genetic alterations to the
germ line.  Goth had developed a genetic formula of sorts that he
believed could produce a child with superior attributes-health,
intelligence, and so forth."

"Did he ever test his formula?"

Dalton looked directly at his wife.  "Not that I know of."

"Why did you take such a risk on something untested?"

Her husband laughed nervously.  "Good question.  I was naive.

And greedy.  All I could think of was the profit it could turn.

Maybe it was best that it all came to such a quick end.  I doubt the
formula would ever have worked."

After a silence, Dalton folded his napkin and dropped it on the
table.

"In any case, the whole venture cost us a lot of money."

He pushed his chair back.  "I'm going back into town tonight.

Meet with Ajemian.  There's supposed to be a snowstorm tomorrow, and we
absolutely have to sit down and review our strategy before we see the
bankers tomorrow.  Ajemian thinks we can arrange for some short-term
financing that'll at least give us a little breathing room--maybe four
or five months.  After that, who knows.  Let's go in and see Genny."

On their way to the nursery they passed the music room.  A light was on
inside, and someone was hitting keys on the piano.

They looked in.  Mrs. Callahan was standing by the door, hands on her
hips.  She turned and greeted Anne and Dalton.  "I'm sorry," she said,
"but she just ran in here.  I was just about to take her back into the
nursery."

Mrs.  Callahan started toward the piano, but Dalton held her arm.

"Wait a minute," he whispered.

Genny was standing between the piano bench and the keyboard, reaching
up to the keys with her right hand and hitting them in a very
deliberate pattern--G, G, F, E, C-sharp, D, A; D, B, A, G, F-sharp, G,
C....

Dalton glanced at Anne.  "Did you teach her that?"

Anne shook her head.  "No.... I played it for her, this afternoon.  I
did guide her fingers over the keys a couple of times.  But that was
all."

The three adults listened while Genny's tiny hand picked out the melody
of "When You Wish Upon a Star."  At the end of the song's refrain, she
hesitated, then moved to her left to reach the keys further down the
keyboard.  She struck those in what appeared to be a random pattern.

Anne clapped a hand to her mouth.  Dalton and Mrs. Callahan looked at
her.

"Amazing," she whispered.  "She's playing the same chords I used--one
note at a time.  Listen .  . . those three notes were a C chor Now an A
Mrs. Callahan nodded.  "Well, she's inherited your musical talent,
Mrs.  Stewart, that's for sure, the little thing."

Dalton Stewart opened his mouth to speak, but no words came out.  His
face had turned quite pale.  He stared across the room at his daughter
as if he had never seen her before.

Ambassador Haikido Mishima stopped and stared up directly over his
head, shielding his eyes from the bright glare of the skylights.  "I
really don't feel entirely secure, walking under those things," he
said.

"Those things" were several large airplanes suspended from the ceiling
of the National Air and Space Museum, on Washington's Independence
Avenue.

Yuichiro Yamamoto followed his gaze.  "I don't think they'll fall on
us," he said.  "American technology isn't that bad."

Mishima chuckled.  "I'm just a superstitious old man.  Here, let's go
this way.  That looks interesting over there."

The two men strolled across the floor to the World War II aviation
exhibit.  Yamamoto had been to the Air and Space Museum many times, and
he never tired of the place.  Mishima, on the other hand, was not much
interested.  The ambassador's tastes tended more toward symphony
orchestras and art galleries than science.

"Is Goth's program completely dead?"  Mishima asked.

"Nothing survived," Yamamoto answered.

"What about that lab assistant of his?  The one who promised to sell us
a copy?"

"Kirsten Amster.  She's disappeared."

"What happened to her, do you think?"

Yamamoto shrugged.  "People disappear on that island all the time.

Despres's security police.  They're the lowest kinds of brutes.

1 79

And I understand she was careless about going out after dark."

"We have no evidence, though."

"No."

"An unlikely coincidence, then, don't you think?"

"It's also possible that the baroness killed her."

"You shouldn't joke about such things."

"I'm not joking, Excellency," Yamamoto replied, annoyed.

"She was suspicious of Amster."

"But why would she care?  Stewart had already beaten her out of the
Jupiter program."

"But she hadn't given up.  It was probably her thugs who set fire to
the laboratory and killed Goth.  She may have been trying to steal the
Jupiter formula.  Amster may have died in the fire with Goth."

"But her body was not found."

"No."

"Surely the baroness is not so ruthless."

"I mention it only as a possibility."

"Do you think the baroness ever obtained a copy of the Jupiter
program?"

"No.  It's been over a year now, and our sources in Hauser Industries
haven't heard anything of it.  And there's no activity in any of their
labs to support the idea."

"Do you think Dalton Stewart has Jupiter?"

"It would only have been prudent for him to protect his investment by
making sure that at least one copy of the program was locked in a
secure place.  That's just my speculation, of course.  No proof.  And
in fact, there's nothing unusual going on at Stewart Biotech,
either."

"What about the Stewart daughter?"  Mishima asked.

"She's normal, as far as we can tell.  No signs of anything unusual.

And we've read all the lab reports."

Mishima nodded approvingly.  "What does that indicate, in your view?"

"Not much.  Except perhaps that Goth's formula is at least not
dangerous."

"But there could be hidden damage, couldn't there?"

"Yes.  Of course."

"And she is only a little over a year old.  Perhaps too early to tell
anything, positive or negative."

"Perhaps."

"That may explain why Stewart hasn't yet done anything with the
program.  He's waiting to see if Jupiter works."

"That could be true also."

"It's really a great shame," the ambassador said, glancing around him
with an anxious frown, "that we didn't get the Jupiter program from
Amster sooner."

Yamamoto cringed inwardly.  He knew the ambassador was going to
criticize him for not moving faster.  He had spent hours mulling over
his failure, trying to anticipate the questions and be ready with the
right answers.  Now that the moment was at hand, he felt nervous and
defensive.  The ambassador was a far more skillful and dangerous
interrogator than his self-deprecating manners would imply.  Still,
Yamamoto knew he was on solid ground.

He had nothing to be ashamed of.  "She wanted a lot of money," he
reminded Mishima.  "And your office was slow to give me the necessary
approval.  By the time it came, it was too late."

Mishima focused his gaze squarely on his companion.  "Ah, but you never
gave us any indication that the matter might be so urgent," he said,
his voice soft as a whisper.

Yamamoto forced himself to meet Mishima's eyes head-on.  "I had no
reason to think it was."

Mishima nodded.  It was a maddening habit of his, Yamamoto
thought--always nodding, whether he agreed with what you were saying or
not.

"In any case, it's too late now," Mishima declared.  "We mustn't
indulge ourselves in recriminations."

My sentiments exactly, Yamamoto thought.

They walked past an exhibit of the Enola Gay, the American bomber that
had dropped the atomic bomb on Hiroshima.  Yamamoto knew that Mishima
had lost relatives there.  Not that that mattered very much to
Yamamoto.  His own grandfather had died at Iwo Jima.  He had lost two
uncles at Okinawa.  And a greataunt had died in an air raid over
Tokyo.

Every family lost members.  He resented the special status accorded
those who had died at Hiroshima, or Nagasaki.  War was war and dead was
dead.

The two Japanese found themselves back in the museum's main hall.  It
was crowded and noisy.

"Jupiter is too important to drop," Mishima said.

Yamamoto waited.

The ambassador leaned toward his companion's ear.  "There remains one
further possibility open to us.  We must try to get DNA samples from
the Stewart child and her parents.  If we can do that, then I think
there is a way we can proceed.  It will be difficult and tedious, but
in the long run it might be the best approach.  In any case, we must be
wise enough to pursue it.  Listen very carefully.  This is what I want
you to do...."

Cooper sat in a soundproof room in the basement of a building on the
huge NSA campus at Fort Meade.  In the ten years that he had worked for
Roy, he had been at Fort Meade only once before.

He hadn't liked it then, and he didn't like it now.

Roy came in with two other men Cooper had never seen before.

One was tall, the other short.  Both wore crew cuts, gray suits, and
that amusing manner of complacent self-importance that bureaucrats high
up in the spy business seemed to favor.  Roy introduced the tall one as
Harry, the short one as Jack.

They each shook Cooper's hand and sat down across the small conference
table from him.  Cooper sensed that he made them uneasy.  His
bone-white hair and ebony skin tended to remind white people of
cannibals.  He ought to get a bone put through his nose, he thought,
and really scare them.

"We're still very goddamned disappointed in what happened at Coronado,
Mr.  Cooper," Harry said.

"We've been through this a hundred times in the last twelve months.

The place was blowing up around me."

"We now know who's responsible for that," Roy said.

"Who?"  Cooper asked.

No one answered him.

"This nigger doesn't need to know.  That it?"

They laughed, embarrassed.

"We've reviewed the tapes from your surveillance bugs," Jack said.  "We
think that the Jupiter program may have survived."

"Yeah?  You know where it is?"

"We're getting close," Harry said.  "We want you to relocate in New
York City.  We've arranged everything.  Even got you a job."

"Oh?"

"At the Hilton hotel."

"As what?  A bellboy?"

Jack shook his head.  "You'll be in the kitchen."  He grinned.

His teeth were bad.  "Have to keep you out of sight, you know."

Cooper bowed his head, doffing an imaginary straw hat in Jack's
direction.  He felt like saying "Yassuh" as well, but he knew that
would be carrying insubordination too far.

"This is important, Cooper," Harry said, his voice suddenly stern.

"Jupiter could be the biggest thing since they discovered the atomic
bomb--" "Bigger," Jack cut in.

"--and if it's that big, then there's only one nation on earth big
enough to own it--the United States of America."

Amen to that, thought Cooper.

On his morning drive into Manhattan, Dalton Stewart tried to think
things through.  He let his head fall back against the plush black
leather upholstery and closed his eyes.  Inside the perfect cocoon of
his limousine it was hard to focus on the reality facing him, because
it was so out of place with the material luxury of his surroundings.

But he knew it was there, lurking somewhere in the dark, waiting to
destroy him.

He had never faced such a crisis before.  His entire multibilliondollar
empire was now in a financial shambles.  He had succeeded in
maintaining an optimistic front in public and before his employees; but
the word was out, and the situation was deteriorating hourly.  Wall
Street was awash with rumors, greatly compounding Biotech's already
crippling money problems.  The company's stock was in a free fall.  It
had lost eighteen points on the New York Exchange yesterday--ten
percent of its value--and he expected worse today.

In the current climate he knew the banks would not give him another
extension to keep Biotech afloat.  In the five months since he had
negotiated the last extension, the situation had not improved.  In fact
it had gotten measurably worse.  He had lost the psychological edge in
his dealings with them.  They simply no longer believed in him.

He wondered why he was begging them so hard, anyway.  Even if the
consortium of banks agreed to a complete rescheduling of

1 84 his debt, it was clear they would do it only on their own terms.

They'd demand a seat on the board and complete financial oversight.

They'd be looking over his shoulder at every business decision.  He
doubted he could tolerate it.

Chapter 11 bankruptcy would be even worse.  It might offer him some
breathing room--hold off his creditors and give him a chance to
reorganize the company.  But at bottom it was too extreme a remedy.  He
would lose financial and operating control.

He would no longer be free to call the shots.  His every move would
need the approval of outsiders--a bunch of bankers, CPAs, and lawyers
whose interests would not be his interests.

Stewart opened his eyes and stared out the window.  A cold spring
drizzle made the dirty streets and ugly houses beneath the expressway
look even more desolate than usual.  The ghost of his father was never
very far from his mind--especially when he thought of Anne and Genny.

They were his only consolation in the rising tide of financial misery
around him.  For the first time in his life, he understood the joys of
being a husband and father.

And now he was being forced to visit this calamity on them.

They would survive, just as he had survived his father's downfall.  But
the family's social position, buttressed entirely by money, would
collapse along with his business.  All the old-line families on whom he
had expended so much effort to ingratiate himself would freeze him and
his family out completely.  He could already imagine their smug
condescension at the news of his ruin.  God, Anne was right, he
thought.  They were never worth the trouble in the first place.

He had to do something.

When the going gets tough, the tough get going.  His father used to
quote that old saw to him all the time, and it used to make him snicker
in derision.  But this time the memory brought tears to his eyes.  All
these years he had missed the truth hidden beneath the disgrace.  His
father, in his desperation to preserve the privileges and position of
his demanding, selfish family--and to preserve what he assumed was the
reason for their love and respect --had risked everything, absolutely
everything, in one terrible, misguided gamble.  He broke the law, he
got caught, and he suffered the consequences.

Suffered them with no small degree of stoicism, Stewart recalled.

And all these years he had despised his father.  Because he had ruined
the good times, because he had made Dalton ashamed of him.  Dalton had
seen only the failure.  He had never considered the tragic bravery.

Now had come his turn to stare ruin in the face--and be brave enough to
risk everything for it.

Hank Ajemian was waiting for him in his office when he arrived.  His
assistant looked more depressed than Stewart had ever seen him.  He was
sitting hunched forward on the sofa by the windows.  The normal dark
circles under his eyes now looked purple and puffy.  His white shirt
collar was wilted and grayish, and his suit was badly in need of
pressing.

"What's the situation?"  Stewart asked.

"We need twenty-four million by the end of the business day
tomorrow."

"I know that.  What about the bankers' meeting tomorrow?"

Ajemian sniffled.  "All they're going to do is give us an ultimatum--no
more extensions, no rescheduling, no new deals, no exceptions, no
nothing."

"They've said all that before."

"This time they mean it.  And we don't have anything left to offer them
to make them change their minds, anyway."

"You've got to buy us some more time at that meeting, Hank --even if
it's only twenty-four hours."

"You're not coming?"

"No."

"What do you expect me to tell them?"

"That I'm raising the money.  Get us an extension until Wednesday.

Tell them we'll have it for them by then.  Absolutely without fail."

A long pause.  Ajemian looked at his boss incredulously.

"Will we?"

"I don't know.  I've got an idea.  If it doesn't work, then I really
don't give a shit what the bankers do.  I'll give them the keys and
take a walk."

Ajemian started to protest, then sensed there was no point.

"Okay," he said.  "I'll stall them.  They can't say no to twenty-four
hours.  When will I know whether or not you've got the money?"

Dalton considered for a moment.  "Tomorrow afternoon," he replied.

"Two o'clock."

"You're not going to tell me what you're doing?"

Stewart didn't like shutting his assistant out on such an important
matter, but he didn't want to have to listen to arguments against his
plan; he might be persuaded by them.  "Not yet.  No."

Ajemian stared at his boss for a few moments, as if trying to divine
his intentions.  "Okay," he said.

By seven-thirty the following morning Stewart was through French
customs at Charles de Gaulle Airport.  He went to a telephone, pulled a
slip of paper from his pocket, and dialed a Paris number.  He prayed.

If Kirsten Amster wasn't there, he wasn't sure what he'd do.  The
number rang eight times.  He hung up, then dialed again.  Ten rings.

He dialed directory assistance.  He made the operator repeat her
information three times, to make sure he had understood the French.

There was no mistaking the message: the city of Paris had no listing
for a Kirsten Amster.

Stewart found a taxi and handed the driver a slip of paper with
Amster's address written on it.

Rue Montgallet was a short and narrow street that connected avenue
Daumesnil with the rue de Reuilly several blocks east of the Gare de
Lyon.  It was in an old working-class neighborhood of the city, and
entirely unfamiliar to the cab driver, who managed two wrong turns
before finally zeroing in on it.

Stewart pulled up his collar and walked down the block to number 15.

It was a cold day.  The same clammy drizzle he had left behind in New
York seemed to have followed him to Paris.

The front door of number 15 was ajar.  He pushed it in and peered
around the small brown-painted vestibule.  He brushed his wet hair out
of his eyes and looked for the buzzer for apartment 3. He found it,
third from the end, over its mailbox.  Garibaldi, the nameplate said.

He checked the names over the other boxes: Abadji, Jusson, Cameon,
Bagoy, Sapon.  No Amster.  He stepped back outside to check the
building number.  It was 15.

A squat, muscular man in a corduroy coat and woolen hat came through
the lobby's inner door, carrying a broom.  The pungent odor of sardines
wafted out behind him into the vestibule.

"Excuse me.  Do you speak English?"

The man shook his head.

"Vous etes le concierge?"

He nodded.

Kirsten Amster, it turned out, no longer lived at that address.

Getting her new address took twenty minutes of hard bargaining and cost
Stewart two hundred francs, but he walked away with a strip of brown
paper torn from a shopping bag with the words "Apt. 6, 32 boulevard
Raspail" scrawled on it in leaky blue ballpoint.

Stewart ducked into the Metro station at the end of the block and rode
across the city to the rue du Bac, a short block from where the
boulevard Raspail branched off from the boulevard Saint-Germain.  The
neighborhood was Left Bank chic, and many rungs up the economic ladder
from the rue Montgallet.  Stewart was seized by the sudden fear that
Amster had sold the Jupiter program to someone else.  That would
certainly explain her move to a better part of town.

Stewart found number 32 a block and a half up.  It was a large,
immaculately maintained four-story apartment building.  The name under
the bell for apartment 6, on the top floor, was Steiner, not Amster.

Stewart pressed it anyway.  No answer.  He looked at his watch: 8:30

A.M. He pressed the buzzer again and held it.

Eventually a sleepy, blurred female voice boomed over the lobby's
static-filled intercom: "Qui est-ce?"

"Kirsten Amster?  Est-elle la?"

"No."  The accent sounded American.

"Does she live here?"  Stewart asked.

"Who are you?"

"Dalton Stewart.... I need to find her."

"Why?  " "An urgent business matter."

"She's not here anymore."

"Do you know where she is?"

There was a long pause.  Dalton repeated the question.  Still no
answer.  "Please," he said, looking pleadingly at the shiny metal
intercom grille.  "If you know her address .  . ."

"Try 9 rue Blondel."

"Where is that, exactly .  . . ?"

"Off the rue Saint-Denis."

"Thank you.  Do you have a phone number .  . . ?"

There was no answer.  The woman had shut off the intercom.

The rue Blondel was in the heart of the red light district.  At this
hour of the morning, with a cold, misty rain falling, the only
prostitutes out were the hardy and the desperate, hunched against the
elements in dark vestibules and doorways, calling out in stage whispers
to the males passing by.

The entrance to number 9 was barricaded by a fat fortyish woman in a
cheap cloth wrap.  She was leaning against the door frame, smoking a
cigarette.

Dalton cleared his throat.  "I'm looking for Kirsten Amster.

Does she live here?"

The woman glanced across the street, then shrugged.  Stewart followed
her gaze.  Two men were watching him from a doorway.

He extracted a hundred-franc note from his wallet and held it out
toward her.  "Kirsten Amster?"  he repeated.

The woman snatched the bill smoothly out his hands and swept it into a
pocket somewhere.  She nodded quickly in the direction of the stairs at
the end of the narrow, shabby hallway behind her.

"Deuxieme etage.  Au fond."

Stewart moved up the stairs slowly, giving his eyes time to adjust to
the dim light.  The place stank of rotting food and urine.

He paused at the second landing and then remembered that deuxieme etage
meant the third floor in France, not the second.  He climbed another
flight.  At the back end of the hallway there was a single scarred
brown door with several locks on it.

He knocked.

After a few minutes of persistent pounding, he heard a voice growl
something in French from the other side.

"I'm looking for Kirsten Amster," he said.

"What do you want?"

"I need to talk to her.  We had a business arrangement."

"Who are you?"

"Dalton Stewart."

A long silence.

"Please.  I must talk with her."

He heard the snap of a lock and the rattle of a chain.  The door opened
an inch.  Stewart saw a dark eye peering at him.  The safety chain was
lifted out of its catch, and the door opened wider.  A puffy, bald,
bearded, middle-aged figure in a gray undershirt looked him over.

Stewart glanced over his shoulder.  The dim corridor behind him felt
vaguely threatening.  "May I come in?"

"You alone?"

"Yes."

The man let him into a small studio apartment--a galley kitchen and
minuscule bath attached to a narrow, airless room with one window, shut
tight and covered by ratty red velvet drapes.  The walls were painted
red, the ceiling light blue.  Both colors were peeling.

A mattress lay on the floor in one corner.  There was little else in
the room--a table, a chest of drawers, a couple of beat-up chairs, an
improvised bookshelf of stacked wooden crates.  There appeared to be no
closet.  Clothes hung from hooks on the wall.

The stale smell of cigarette smoke and human funk was strong.

Despite the desperate tawdriness of the place, it was surprisingly
neat.  The floor looked clean, and a stained quilt was tucked neatly
over the mattress.  There was a single lamp on the floor beside the
mattress, and a stack of books on the quilt.  A pile of pillows propped
against the wall indicated that the man had been reading.

"My name is Joe Slater," he said.  He sat at the table and gestured
toward the other chair.  Stewart walked over and sat down.

Slater waved a hand around, inviting his guest to take in the
surroundings.  "Not exactly avenue Foch, is it?"  he joked.

"Are there some people watching you?"  Stewart asked.

Slater laughed.  "You mean those guys across the street?"

"Who are they?"

"Fucked if I know.  I don't pay any attention to them."  Slater looked
toward the kitchen.  "I got a couple of beers in the fridge.

Alsatian, not too bad...."

"No thanks."

"A man never thinks his life'll come to this," Slater said.

"Christ knows I didn't.  I would have thought this romantic as all hell
when I was in my twenties.  But now .  . . now it's just pathetic.

I'm pathetic.  I'll be fifty-three next birthday.  I really didn't
expect to live this long, you know that?  I guess that's part of my
problem.  I've outlived myself.  Hey, but you didn't come here to
listen to my problems."

"I'm looking for Kirsten Amster."

"Yeah, you told me."

"Does she live here?"

"Not anymore."

"Where does she live?"

Slater's eyes narrowed.  "She doesn't live anywhere.  She's dead."

The news jolted Stewart powerfully.  When he had recovered, he asked
what had happened to her.

"She drowned.  In the Seine.  Last October."

"An accident?"

"That's what the police say.  I think she was killed."

"Why?"

"That fucking genetic computer program."

"I paid her for it over a year ago.  She cheated me.  She sold me a
disk with only half the program on it."

"You're not the only one.  Everybody was after her for it."

"Everybody?  Who?"

"I don't know who they were.  It was none of my business.  I told her
to get rid of the fucking thing.  But no.  She kept dangling it out
there, like bait, and upping the ante.  She said she was going to make
a killing with it.  Well, she did that all right."

"Did she sell it to anybody?"

"No."

"You sure?"

"Positive."

"What happened to it?  Do you know?"

Slater took a sip of his beer and said nothing.

"Do you have it?"

Slater looked Stewart over.  "Yeah, I have it.  Or I should say I know
where it is."

"I'll pay you for it."

Slater gazed at him with his sad, rheumy eyes.  After a pause, he shook
his head in resignation.

"Ten thousand dollars," Stewart said.  "Five in cash today.  The rest
as soon as I can verify that it's genuine."

Slater still didn't respond.

"I've already invested a small fortune in that program," Stewart
added.

"And I've already paid for it once.  It's really my property."

Slater rubbed his face and sighed.  "I won't argue with you, Stewart.

But if I were you, I'd forget about it.  Leave the goddamned thing
alone.  It's cursed.  Look what happened to Goth.

Look what happened to Kirsten."

"Will you take the offer?"

"What are you going to do with it?"

"Develop it, of course."

"Of course.  And make more billions, right?"

Stewart didn't bother to reply.

"What do you need more money for?"  Slater demanded.  "What the hell do
you do with it all?  Does it make you feel good?  Secure?

Superior?  What does it do for you?"

"It's a measure of success," Stewart answered.  And failure as well, he
thought.

"Is it?"

"Most people'd say so."

"Sort of a way to keep score, eh?  The guy with the most marbles
wins."

"Something like that."

Slater yawned.  "You know what?  It sounds pretty fucking boring."

Stewart felt the need to justify himself.  "Not for me it isn't.

There's plenty of risk.  Uncertainty.  You'd be surprised."

"Probably.  You're taking a big risk here, I'll tell you that."

"Why?"

"I told you.  The program's cursed.  This guy Goth was playing God.  He
was fucking around with the fundamental mystery of life on earth.  He
was creating his own specs for building a human being.  Stealing God's
own thunder.  Or trying to.  How blasphemous can you get?  But it so
happens I need the money...."

"Where is it?"  Stewart demanded.

"Where it belongs.  In Hell."

"Hell?"

Slater laughed.  "Yeah.  The Paris version."

Leonora, the Stewarts' upstairs maid, came into Anne's bedroom and
began dusting the furniture.  She paused at the dressing table, picked
up one of Anne's hair brushes, and examined it, looking for loose
strands of hair in the bristles.  There were none.  Two other brushes
on the table were similarly clean.

She went to Anne's bed, picked up a pillow, and carried it over to a
window.  She found several strands of Anne's hair on the pillowcase.

She removed them carefully, then fished in her apron for the small
letter envelope.  She folded the strands inside, licked the flap, and
sealed it shut.

After cleaning the bathroom and making Anne's bed, Leonora went into
the bedroom across the hall from Anne's, where her husband, Dalton
Stewart, usually slept.  She located more strands of hair on the
pillowcases on his bed and sealed them in a second envelope.

She made his bed, cleaned the bathroom, dusted the furniture, and then
moved down the hall to the room where the Stewarts' daughter slept.

She examined the crib mattress and the bumper for loose hairs, but
could find none.  She located a few strands on the changing table
nearby, but it was impossible to be certain whose head they had fallen
from--the child's, her mother's, or her nanny's.

Leonora finished cleaning the front rooms and moved to the north
wing.

Mrs. Callahan was in the nursery, reading a magazine.  Whenever
Leonora saw her, she seemed to have her nose

1 94 stuck in a magazine.  Except when Mrs. Stewart was around, of
course; then she was all bustle and business.

The Stewarts' daughter was sitting in the middle of the floor, stacking
alphabet blocks.  Mrs. Callahan looked up, saw Leonora, and turned
back to her magazine.  As for the child, she was concentrating so
intently on her blocks that she seemed not to notice the maid's
entrance at all.

She was a beautiful Anglo child, Leonora thought, with the same angelic
disposition as her mother; but there was something disturbing about
her.  The girl had a peculiar way of looking at you.  She acted as if
she were seeing something on you--as if you had a big spider crawling
on your head, or something.  It was a little bit spooky.

Leonora sometimes wondered if the child might be possessed.

Her aunt Carolina, in El Salvador, had seen such cases.  Still, there
was nothing evil about the girl that the maid could see.  It was just
that funny look she had, as if she were seeing things that weren't
there.

The maid dawdled, stretching out her cleaning chores, hoping Mrs.
Callahan might leave the room for a moment.  She knew the woman
suffered from a bladder problem.

Leonora turned on the vacuum cleaner and worked it back and forth on
the carpet.  Genny waved her little arms, afraid the vacuum was going
to knock over her blocks.  The maid moved the machine around them with
great care.

Finally Mrs.  Callahan stood up.  "Watch her for me, Leonora.

I'm going to the bathroom."

"Yes, ma'am."

The moment the nanny disappeared through the doorway, Leonora turned
off the vacuum and knelt behind Genny.  From her apron she extracted a
small pair of fingernail scissors and quickly snipped off a strand of
Genny's blond locks.  The girl felt the back of her head with her hand
and quickly looked around.

"Buenos d1as, nina," Leonora said.  "Que tal?"

"Buenos dr'as," Genny replied, imitating the maid's accent perfectly.

"Why did you cut my hair?"

"Just a little piece," Leonora said, tucking the hair into a third
envelope and sealing it.  "For my collection.  I collect hair from all
my friends."

Genny regarded the maid with those laserlike gray-blue eyes.

"I think that's silly," she declared, in a very adult voice.  She
turned back to her blocks.

Mrs. Callahan returned and Leonora quickly finished her cleaning.  As
she was leaving, the alphabet blocks Genny was playing with suddenly
caught her attention.  The maid had been studying English very
diligently, and she was proud of her reading ability.

Genny had arranged some of the blocks in a long line.  The side facing
Leonora showed all capital letters: WHATEVERYWOMANSHOULDKNOW.  At first
they appeared to be randomly arranged, but on closer inspection,
Leonora thought that they spelled out something.  She puzzled over them
a few moments longer.  Then the individual English words jumped out at
her: "What every woman should know."

"Madre de Dios," she whispered.  She hurried from the nursery, feeling
short of breath.

Later, riding into town with Mrs. Corley, the housekeeper, Leonora
realized that what the girl must have done was copy the letters from
the cover of one of Mrs. Callahan's magazines.  She couldn't remember
seeing any magazine on the floor anywhere near the child, however.  And
she had vacuumed every inch of it.

How could that little nina be so smart?  The child must be a very
special gift from God, she thought.  Or the Devil.

In town, Leonora met the man in the greeting card aisle at the big CVS
drugstore, as arranged.  He dressed very well and had excellent
manners.  That seemed to be true of most of the Asians she had seen
since coming to the United States.

She gave him the three envelopes.  She had marked them clearly, but he
ripped them all open right there in the aisle and looked inside each
one.  Finally he nodded and smiled and told her that she had done an
excellent job.

She had met him the week before.  He worked for a big shampoo
manufacturer.  His company was doing a big study on rich women's
hair.

It was all part of a major project to develop a new shampoo.  Muy
importante, very hush-hush.  She had to promise

J u t .  .. w .  ...never to tell anyone of her secret little mission
on the company's behalf.

He handed her an envelope from his inside suit pocket and, with a small
bow, turned and left the store.  The envelope contained five
twenty-dollar bills.

The man's story was a bit farfetched, but Leonora hardly cared.

If he wanted a few strands of someone's hair, what could be the harm?

Especially if he was willing to pay her a hundred dollars for them.

Leonora slipped the bills into her purse.  And speaking of hair, she
thought, she ought to take a look at those elegant new electric razors
for women she had noticed at the front counter.

Dalton Stewart and Joe Slater emerged together from Slater's studio
apartment on the rue Blondel.  The fat woman was still by the doorway,
smoking a cigarette.

Stewart noticed a couple of prostitutes huddled in the shadows of a
narrow alleyway across the street.  Behind them, Stewart glimpsed the
same two men he had seen earlier.  They were sitting on chairs tilted
back against the alley wall.  As soon as they saw Slater and Stewart
they stood up.

"Are they going to follow us?"  Stewart asked.

"Afraid so."

"Who are they?"

Slater pulled up the collar of his coat against the damp.  "I told
you--I don't know."

"You know what they want?"

"What do you think?"

Stewart watched the men out of the corner of his eye.  They had come
out of the alley and were walking single file along the narrow sidewalk
on the other side of the street.  Their presence unnerved him.  "How do
they know you have it?"

"They don't," Slater said.  "Right after Kirsten was killed some people
approached me and offered me money.  I told them I didn't know anything
about any computer program.  After that, these guys appeared.  I've
tried a hundred times to shake the bastards.

I even moved twice.  But somehow they always find me again.

1 9 8

They've ransacked my apartment five times.  They're waiting for me to
lead them to Jupiter.  I know it."

"What are we going to do?"

"Lose them.

They took the Metro to Denfert-Rochereau, changing cars several times
en route.  From there they walked a few blocks down the boulevard
Saint-Jacques, turned right onto the rue Dareau, then left onto the rue
Broussais, and finally left again onto the rue Cabanis, which ran along
the grounds of the Centre Hospitalier Sainte-Anne.

Slater stopped in front of a small shop window.  "Let's wait here.  See
if they're still around."

Five minutes passed.

"No sign of them," Stewart said, getting impatient.

"Don't be hasty.  They're clever bastards.  Follow me."

Slater retraced their route all the way back to Denfert, his eyes
probing every doorway, alley, and storefront for any sign of a tail.

Satisfied at last that they had lost them, he led Stewart along an even
more circuitous route back to the rue Cabanis.

"This way."  Slater climbed over the low stone wall that bordered the
hospital's small park.  Stewart followed, feeling increasingly
foolhardy.

Slater led him a short distance through some heavy bushes until they
came to a low shed used to store equipment for ground maintenance.

Slater yanked open the shed's door and ducked inside.

He took a shovel leaning against the back wall and scraped several
inches of dirt from the floor until he had unearthed an old iron
manhole cover.  He pried the cover up with the blade of the shovel and
slid it aside.

Stewart peered down into blackness.  "Where the hell does it go?"

"To the catacombs," Slater replied.  "Kirsten's idea.  She had a job
here at the hospital lab.  Some co-workers showed her the entrance.

They used to go down here sometimes, just for the evil thrill of it.

Used to party down there, she told me."  Slater pulled a pair of small
flashlights from his pocket and handed one to Stewart.  "You'll need
this."

Slater lowered himself into the opening, feeling for the top rungs of
the iron ladder attached to the stone-lined walls of the well.  He
turned on his flashlight and began a cautious descent.

Stewart took a deep breath to steady himself, then followed.

A hundred rungs down, ten stories under the city of Paris, Slater
stepped off the ladder onto a dirt floor and shined the flashlight
around.  Stewart, his arms and legs trembling from the exertion,
reached the floor right behind him.

They were standing at the edge of a network of underground passages
that honeycombed the earth underneath the "three mounts" of south
Paris--Montsouris, Montrouge, and Montparnasse.  The huge warren of
tunnels dated back to the Roman era.

Sections of it were open to tourists during the summer months.

But now, in early spring, the catacombs were locked, cold, and dark.

Slater led the way, stepping carefully, swinging his flashlight back
and forth ahead of him to scare off the numerous rats that inhabited
the dank underworld.  He frequently caught their eyes in the light, and
their dark brown backsides as they scurried into the protective dark.

"Christ, they're as big as cats," Stewart said.

"The French Resistance used the catacombs to hide out from the
Germans," Slater replied.  "The krauts were afraid to come down here.

I'm not too crazy about it myself.  It's goddamn spooky."

Stewart agreed.  It was all he could do to fight off the impulse to
turn and flee back up to the surface.

After nearly a mile's walk through damp-walled, narrow tunnels, they
arrived at the section known as the Ossuary.  Here, in countless rows
along the cave walls, were arranged the bones of hundreds of thousands
of skeletons removed from the cemeteries of Paris at the end of the
eighteenth century.  The long galleries of neatly stacked human skulls
and tibias branched out in every direction to form a uniquely macabre
spectacle--a veritable subterranean world of the dead.

Stewart followed the beam of his flashlight, staring openmouthed at the
morbid panorama that surrounded them.  It was l so utterly ghoulish, he
thought--like a scene from Dante's Inferno, or the literal Hell of a
medieval morality play.  Stewart shivered involuntarily.

They arrived at a small, steep-vaulted chamber off the main galleries,
where the bones were arranged in a low semicircular wall to form a kind
of altar.  Slater shined the flashlight through the eye sockets of a
skull sitting at the top of a neatly stacked pile.  He patted the
skull.  "Probably a beautiful woman, once upon a time.  Or maybe a
whore with the pox.  Or a thief who beat his wife.  Hell, maybe it was
Marie Antoinette.  We'll never know."

The stale, humid air seemed to swallow up Slater's words even as he
spoke them.  Stewart shuddered again.  "Hurry the hell up.

This place is getting to me."

Slater lifted the skull from the top of the pile, set it aside, and
reached in among the bones to retrieve a metal strongbox.  He twirled
the tiny combination lock and the lid popped open.  Inside, swathed in
several layers of bubble wrap, was a single black plastic RCD computer
cartridge.  Slater closed the box and handed it to Stewart.  "You take
it.  I don't even want to touch it.  As I said before, the fucking
thing's cursed."

Stewart tucked the box under his arm.  He felt immense relief.

"This is the only copy?"

Slater laughed.  "You want to look around for others?"

Stewart shook his head.  "Let's get out of here."

They started back.  A little way along the tunnel, something fell to
the ground behind them.  It made a soft plop as it hit the damp dirt
underfoot.  Stewart whirled around, pointing the flashlight down the
pitch-black passageway.  Nothing.  His pulse was racing.

"Just a bone," Slater said.  "Knocked over by a rat."

They increased their pace.  The humid underground atmosphere caused
Stewart to break out into a sweat.

They came to a place where the tunnel divided into two separate
passageways.  Slater stopped.  "Did you hear something?"

"No."

"Listen.... A soft drumming sound."

Slater directed his flashlight down one branch of the tunnel, then the
other.  In the second passage the beam of light picked out a crowd of
rats, galloping toward them.

Slater froze.  Stewart immediately turned and fled.

Fifty yards down the tunnel he was soaked with sweat and his heart was
pounding.  The floor of the passage was uneven, and Stewart, in his
panic, stumbled and fell.  The rats shot right on past him, hugging the
edges of the tunnel on each side of him.

Stewart scrambled back to his feet.  The strongbox with the cassette in
it had slipped from his grasp.  He found it in the dirt and picked it
up.

He brushed off his pants and jacket and stood, catching his breath.  He
was shaking.  Stupid, he thought, letting a few rats throw such a scare
into him.

He shined the light down the passageway.  No sign of Slater.

Which way had he come?  He looked down the other way.  The long dark
tunnel looked the same in both directions.  He called out to Slater.

No answer.

Stewart knelt and tried to find his footprints on the floor, so he
could determine the direction in which he had come.  The dirt was
packed so hard it was impossible to make out anything.

He stood up and called Slater's name again.  Still no answer.

He called out a third time.  The walls seemed to muffle his voice,
soaking up the sound before it had traveled any distance at all.

Finally he thought he heard something faint far down the tunnel.  A
yell?  A scream?  Slater.  It was certainly Slater.  He took off at a
trot back down the tunnel toward the sound.  He came back to the place
where the tunnel divided.

He heard Slater's voice again.  It was coming from the tunnel on the
left.  He started to call, then checked himself.  Slater was talking to
someone.  He sounded agitated.

Stewart advanced cautiously along the tunnel, listening.  Slater's
voice was getting closer, but numerous alcoves branched off both sides
of the tunnel, and Stewart couldn't locate the exact direction of the
sound.

Then the main passage curved sharply to the right.  Stewart stopped and
turned off his flashlight.  He could see faint light reflected off the
tunnel wall ahead of him.  He approached on tiptoe and looked around.

He saw Slater.  He was on his knees, squinting into the bright glare of
a flashlight, and struggling to stand.  Two men were standing over
him.

The quick blur of a boot flashed through the beam of light and hit
Slater's stomach.  Then an arm with a club descended against Slater's
skull.  Slater grunted and slumped faceforward into the dirt.

The men watched him for a few seconds, then began swinging their clubs
methodically against his skull, taking their time in the wavering light
of their flashlights to land their blows on target.

Stewart dared not move or breathe.

Finally, mercifully, they stopped.  One felt Slater's neck for a pulse,
then said something in German.  They ransacked his pockets, then ripped
his clothes off and looked through them frantically.  Unable to find
what they were looking for, they got to their feet.  One of the men
kicked Slater in the side of the head.  They exchanged a few words and
then started off in Stewart's direction.

Stewart ducked into one of the alcoves.  They passed by him without
seeing him and vanished up the passageway.

When he was sure they were some distance away, Stewart edged back to
the corner and turned on his flashlight.

Slater lay motionless on his back.

Three rats had already found him.  They were creeping around him,
tentatively sniffing, touching.  One climbed onto his stomach and
walked across it, scratching and sniffing.

Stewart shook his head.  He felt on the verge of throwing up.

He turned and retreated back the way he had come.

They had to know he was down here, he realized.  They would likely wait
for him at the top of the long ladder in the tool shed in the garden of
Sainte-Anne.

He would have to find another way out.

For over an hour Stewart roamed the dark labyrinth of underground
passages.  He began hyperventilating.  He shook and trembled and his
clothes were drenched in cold sweat.  He talked out loud to himself to
fend off the building waves of terror.  The additional fear of a
possible heart attack forced him to stop and catch his breath.

When his pulse had slowed, he set off again, moving at as fast a pace
as he dared.  His heart thumped, loud and fast and heavy, like the
footfalls of someone running for his life.

He kept imagining he could hear real footfalls, pounding in the dirt
behind him.  A hundred times he shined the flashlight behind him to
make sure no one was there.

The flashlight eventually began to dim.  The thought of losing the
light altogether sent a fresh shock of panic through him.  He started
turning it off and on at intervals to preserve the batteries.

Just as the flashlight failed completely, Stewart stumbled onto a
large, sturdy circular stairway.  He felt his way up the dozens of
steps in the pitch-dark.

At the top he found himself in a small building on the place
Denfert-Rochereau.  Sun was shining in the windows.  There were signs
and a ticket booth.  It was the tourist entrance to the catacombs.  No
sign of anyone watching.

Thank God, thank God.

The outside door was locked.  He opened a window and climbed out.

After a change of clothes at his hotel, Stewart checked out of his
suite and took a taxi to Orly Airport.  In an hour he was on a plane to
Munich.

On the ride in from the Munich airport Dalton Stewart popped a couple
of ibuprofen caplets into his mouth.  Earlier, after the terrifying
episode in the catacombs, he had swallowed a Halcion tablet to calm his
nerves, but it hadn't worked.  He could feel the pill's chemicals
thrumming through him; but instead of boosting him into a kind of
aggressive alertness, they had kicked his sleepstarved system over the
edge.  He felt raw, punctured--as if his strength and courage were
leaking out of him.  A look of ragged desperation was not the look to
bring to a meeting with Gerta von Hauser.  Especially this meeting.

The baroness greeted him in her office with a kiss and then stepped
back and looked him over.  She seemed pleased to see him again.

They had parted on ambiguous terms.  Their affair, if it could be
called that, had ended the same night that it had begun--in the frenzy
of the New Year's celebration at President Despres's palace in
Coronado.  Stewart had had no communication with her since, but he had
thought about her frequently over the past year and a half.

"You look rather haggard, Herr Stewart," the baroness said, in her
overrounded English accent.  She offered him a seat beside her on a
long leather sofa.

Stewart sank into the cushions.  His eyelids felt heavy.  "Too many
plane flights," he complained.  "It's the damned recycled air.

205

I think the pilots must get a kickback from the airline on every
canister of unused oxygen they save."

The baroness murmured something in agreement.

She looked better than he had remembered her.  She was wearing a
hand-tailored charcoal-gray business suit.  It was subdued but
flawlessly cut, draping her lithe figure perfectly and presenting a
striking foil for her magnificent blond hair, which she now wore
long.

He mustered the energy to throw out a few compliments.  The baroness
gave him a quick, impatient smile.  She asked about Anne and their
child but didn't appear much interested in Stewart's answer.  She
wasn't one to waste time on small talk, anyway.  She moved directly to
the point: "Naturally I am curious to know why you have come to see
me."

Stewart reached down for his attache case, clicked open its brass
snaps, and pulled out a black plastic RCD.  He held it up in front of
her.  "You know what this is?"

Her eyes focused on the object, then back on him.  "I expect you're
going to tell me."  She smiled.

Stewart placed the RCD on the low marble table in front of the sofa.

"It's Goth's Jupiter program."

The baroness seemed slightly startled.  "Where did you get it?"

"I had the foresight to acquire a copy before Goth's death."

He was oversimplifying considerably, but he had no intention of telling
her about Slater and the catacombs.

The baroness picked up the cartridge and turned it over in her hand
several times, as if she were examining a small sculpture for flaws.

"Why have you not done anything with it?"

"I didn't think it worked.  Now I know that it does."

The baroness looked mystified.  "And you want me to help you develop
it?"

"Exactly."

"Why do you come to me?  Why don't you test it yourself?"

A wave of faintness forced Stewart to close his eyes for a few
seconds.

He bent his head down and pretended to study something on the floor
until the sensation had passed.  "I need backing," he said.

"It can't be very expensive to set up a trial...."

Stewart's mouth was dry.  He licked his lips and tried to suppress the
humiliation he felt.  "No.  You don't understand.  I'm in financial
trouble.  Biotech is facing bankruptcy."  His voice stumbled on the
word "bankruptcy.

The baroness settled back against the sofa and crossed her arms.  A
visible thrill of satisfaction lit her face.  "And you hope to save
yourself with this?"  She nodded in the direction of the black plastic
cartridge on the table in front of them.

"I'm willing to offer you a large percentage.  In return for enough
cash to get the banks off my back."

"How much cash is that?"

"Twenty-four million."

"You can't raise even that much?"

"If I could I wouldn't be here."

"I see."  The baroness seemed suddenly offended.  She moved from the
sofa to her desk, as if to distance herself from Stewart's request.

"You expect me to give you twenty-four million for only a share of the
program's profits?"

"Baroness, the twenty-four million is a loan.  You'll be paid back in
full.  I'll even leave the terms to you."

"What equity are you offering me?"

"Fifty percent of Jupiter."

The baroness shook her head.  "That's not equity.  That's-what's the
American expression?--a pig in a poke."

"I'll put up the necessary shares of Biotech as collateral as well.

God knows I'm not trying to cheat you.  The banks have gotten cold
feet.  I'll have to file a Chapter 11 and try to reorganize."

"How soon do you need this money?"

"Immediately.  Today."

The baroness swung her chair away from the desk and gazed thoughtfully
out the window.  Stewart had laid out his position naked and
unadorned.

He knew his desperation was showing, but he was too exhausted to try to
paint a less stark picture of his situation.  She would likely see
through any obfuscations anyway.

The baroness swiveled her chair back to face the desk.  She brushed
some imaginary dust from the desk's polished surface.  "I cannot do it,
Herr Stewart.  And certainly not on such short notice."

Stewart listened for even a trace of indecision in her tone, but he
heard none.

"Even if you have the real Jupiter, I have no faith in it," she
continued.  "Not anymore.  It hasn't been tested.  It may be
worthless.

As for your Biotech stock, that can't be worth much, either, if your
financial situation is so bad."

Stewart held up a hand in protest.  "The company's basically sound.

That's the irony of the situation.  We overextended and we had some bad
luck.  Goth's death to begin with, of course.  And then some damaging
lawsuits, coupled with a major business recession.  But these are all
surmountable problems.  All we need is a little time.  But the damned
banks are running scared.  They're in bigger trouble than Biotech, and
they're looking for assets to shore up their own shaky finances."

"You've made some bad business decisions," she countered.

"Don't blame the banks."

Stewart drew a breath to rebut her, then let it out in a long, tired
exhalation.

"Would you like something to drink?"  she asked, suddenly solicitous.

"Yes.  Black coffee."

The baroness called an assistant on the intercom and gave the order.

They looked at each other.  The baroness shrugged.  "I'm really sorry,
Dalton, but you're not making me a realistic offer.

I'm surprised that you even came to me for help."

He didn't reply.  He still had his hole card, and he was thinking how
best to play it.

The coffee arrived.  The baroness fussed impatiently with the ruffles
of her blouse as he drank it.  She had given her decision, and now she
wanted him to leave.

Stewart picked up the RCD and held it out in front of him.

"Baroness, we once fought each other for this.  Because we were both
smart enough to know how much it could be worth.  Now here it is.  And
I'm offering to cut you in on it--not just because I need your help but
because there's enough profit here for both of us.  It could make us
the two richest individuals on the face of the planet."

"I'm sorry that I can't help you."

Stewart opened his attache case again.  He put the cartridge back
inside and pulled out a videotape.  "Do you have a VCR?"

"Dalton, I'm a very busy woman...."

"It'll only take a few minutes.  It'll be worth your time, I
promise."

The baroness opened a panel in the wall near a wet bar to reveal a
large TV and VCR.  He handed her the tape.  She inserted it in the
machine and waited.

"What is it, for heaven's sakes?"  she demanded.

"Watch.  You'll see."

A little girl appeared, wearing a pink dress.  She looked at the camera
and smiled.

"Our daughter, Genny," Stewart explained.

The tape showed Genny progressing in age through a series of standard
home video scenes--breast feeding, playing with her dolls and stuffed
animals, eating at her high chair, taking her first steps, running
around the house, playing with her mother and father, playing with her
nanny.

"This was put together from several hours of videotapes done over the
course of Genny's first year," Stewart explained.  "There she is down
at the guest cottage last summer.  She was walking at six months."

The next scene showed Genny talking.  Her mother's voice offcamera was
asking her to introduce her stuffed animals.  She held up each one in
turn and recited its name.

The baroness crossed her arms impatiently.  "What is the point of
this?"

"This last scene was taped a few months ago," Stewart said, ignoring
her.  "Genny's fourteen months old here."

The camcorder zoomed slowly in on Genny, standing in front of a grand
piano, rubbing her hands energetically along the bench seat.  Suddenly
she turned to face the keyboard and began playing the melody to "When
You Wish Upon a Star."  She played it once through, perfectly, then
stopped, turned, and smiled at the camera.

The tape ended.  The baroness reached forward, stopped the VCR, ejected
the videotape, and handed it back to Stewart without a word.  She
walked to her desk and then turned around to face him.

Stewart followed her across the room.  "Do you need an explanation?"

She shook her head.  "You do amaze me, Dalton.  Mein Gott .  . ."

There was genuine admiration in her tone.  "I can see its advantages
instantly.  It let you be the first to know whether or not Jupiter
worked.  Quite inspired, really."

Dalton returned the videotape to his attache case.  His exhausted body
felt a feeble but encouraging trickle of hope.

"But your wife was not afraid?"

"No."

"She was quite brave."

"Not exactly.  I didn't tell her."

"How was that possible?"

Stewart explained that Anne thought Goth was making a single repair to
one known genetic defect.  "No one knew.  It was between Goth and
myself."

"And your wife still doesn't know?"

"I think it's better not to tell her.  At least not yet."

"No one else knows?"

"You're the first."

The baroness kept shaking her head in disbelief.  "You have had the
girl tested?"

"I have her medical records with me.  She's completely healthy.

No problems at all.  No abnormalities, nothing.  She's a superior child
in every way."

The baroness pulled a stack of letters from her In box, sat down, and
began signing them.  "Perhaps it's only a coincidence.

There are such things as child prodigies, you know."

"You don't believe that."

The baroness shrugged.

"Fifty-fifty share," Stewart said.  "Plus fifty million in stock, on
whatever terms you want.  All you have to do is put up twenty-four
million cash, now."

"I'll think about it."

"I don't have time."

The baroness tossed the stack of signed letters into her Out box.

"Give me two hours, then.  I'll talk to my lawyers."

"Of course."

"I can't promise anything."

"I understand."

"It's three now.  Come back at five-thirty.  I'll have an answer
then."

"Five-thirty," Stewart repeated.  He picked up his attache case and
left.

The two and a half hours passed with excruciating slowness.

Stewart walked the streets of Munich, ate a bratwurst and drank a glass
of beer in a cafe, then walked the streets some more.

He knew he was taking a tremendous risk.  He was practically putting
his future in her hands.  But he believed that he could control her.

There was not a shred of evidence to suggest that she could be
manipulated by him or by anybody--quite the contrary--but his ego
wouldn't permit him to think otherwise.

When he returned to her office, the baroness was no longer alone.  A
narrow-headed man in his forties, with slicked-back hair, a high
collar, a toothbrush mustache, and a sour expression, was sitting
beside the baroness's desk.  Stewart was immediately encouraged.  This
looked like her money man.

The baroness introduced him.  His name was Richard Spengler--a company
lawyer.  Stewart shook his cold, damp hand and sat back down on the
sofa.

"I wish to make a counteroffer," the baroness said in a brisk voice.

"I'm listening."

"I will loan you the twenty-four million dollars on the following
conditions," she began, dropping her gaze to a sheet of paper on the
desk in front of her.  "One, an equal share with you of all profits
from the Jupiter program.  Two, a fifty-one-percent interest in Stewart
Biotech.  The twenty-four million dollars will be paid back either out
of your profits on Jupiter or directly from gross, pretax earnings of
Stewart Biotech, whichever becomes available first.

For my part, I'll agree to undertake all initial expenses for
developing the program--finding a suitable test site, outfitting and
staffing a clinic, arranging for trials, and so on.  When you've
recovered your financial position, we'll share all future costs
equally.  There remain a lot of details to settle, of course, but those
are the principal points.  If you accept those, we can conclude an
agreement."

Stewart's jaw tightened.  "Fifty-one percent?  You expect me to give
you controlling interest in Stewart Biotech?  For a
twenty-four-million-dollar loan?"  He said this in a very loud voice.

The baroness exchanged glances with Herr Spengler.  He pursed his lips
primly and nodded.

"The only way I can protect a loan that large is to have control over
the company using it," she replied.

"Even the banks aren't that greedy."

The baroness folded her arms.

"The answer is no," Stewart said.  "You'll have to accept much less.  I
offered the stock as security.  As collateral.  That's all.  Until the
loan is paid back."

"That's not good enough.  I want stock."

"If you want stock, you can't expect a cash repayment of the loan as
well.  That's absurd."

"That's my offer, Dalton."

He thought the baroness was just staking out a tough bargaining
position, but she wasn't.  She meant her original offer to stand.

That was it.  Period.  Take it or leave it.  Stewart argued heatedly
with her for half an hour, but she refused to budge.

He left her office, finally, telling her that he needed some time alone
to think.  He felt sick, confused, and angry.  The woman was
unbelievable.  She knew she was his last hope, short of bankruptcy, and
she intended to extract the maximum from him-strip him of everything
she possibly could.

He went outside and walked the streets again.  It had begun to rain
hard.  He pulled his coat collar up around his neck.  He was shivering
violently, and his joints and his muscles ached.  His knees felt so
weak and rubbery he feared that he might fall down.

He retreated into a bar, ordered a drink, and downed another Halcion.

She had calculated her offer with a brutal precision, he thought.

No matter how much he hated it, it still came out as the best
alternative.  It boiled down to a choice of giving control to her or to
the banks.  And the banks wouldn't lend him the money he needed to
develop the Jupiter program.  And that was what mattered.  If he could
just get the baroness to back off from her demand of controlling
interest, he decided, he'd accept her offer.

Then Jupiter would get developed, and it was Jupiter, after all, not
Stewart Biotech, that held the key to a vastly richer future.

And he was pretty sure she'd accept less than controlling interest in
Biotech.  She was too smart--and too greedy--to hold out for the
impossible.

And there was another reason.  He had heard the men in the
catacombs--the same men who had been watching Slater's apartment--speak
German.  It was close to certain they had been sent there by the
baroness.  Despite her tough bargaining stance, she still wanted
Jupiter as much as he did.

He called the baroness from his hotel.  "Forty percent of all common
stock," he said.  "And two seats on the board.  Take it or leave it."

"Fifty percent and four seats on the board.  That's the best offer I
can possibly ever give you, Dalton."

"Sure.  Forty-five percent and three seats.  And that is the best
you're ever going to get from me."

There was a long silence on the other end of the line.  Stewart waited,
holding his breath.

"Very well."

"Good.  Draw up the papers.  I'll initial a draft tonight.  Tomorrow
I'll send Hank Ajemian over to hammer out the details.  I'll need you
to transfer twenty-four million dollars to my bank in New York by noon
tomorrow.  I'll give you the account number tonight."

"I'm pleased," the baroness admitted, when they had settled their
deal.

Suddenly her voice was warm, sensuous.  "It'll be a great adventure, I
think."

Stewart didn't reply.

"Oh, there is one other condition," she added.

"What's that?"

"Your daughter, Genny.  I'd like to meet her very much.  If she's the
living proof that Jupiter really works, I must see her myself, don't
you agree?"

"Of course," Stewart said.  "Why not?"

He hung up the phone and collapsed heavily onto the bed.  He pulled the
comforter up over himself and fell asleep, fully dressed.

A last hurried survey of the situation downstairs assured Anne that
everything was in order.  Amelia, the cook, was working furiously on
the menu; the servers were properly dressed and instructed; the wines
were chilled, the bar was set out, the hors d'oeuvres made; the newly
decorated dining room was spotlessly clean, the silver was polished,
the places set, the candles and the flowers arranged.

Anne rushed upstairs to change.  Guests would be arriving in fifteen
minutes.  Dalton was already pacing the downstairs halls impatiently,
drink in hand.

Her husband had so many times in the past reminded her that her
performance as a hostess reflected on him that she was invariably in a
state of nervous apprehension whenever they were entertaining.

But tonight she was more anxious than normal.  This dinner was no
ordinary affair.  It was for Stewart's business partner, the Baroness
Gerta von Hauser.  Every time Anne thought of the word "baroness" she
felt her throat constrict.  God knew what the woman was accustomed to,
but it had to be pretty grand.  She was not only a baroness, she was
the head of a huge European business conglomerate.

Dalton had gone out of his way to reassure her.  The baroness, he said,
was really very likable and easygoing--not at all the demanding
autocrat some had made her out to be.  But beneath her husbands
assurances Anne detected his own nervousness.  Thewoman had recently
saved Stewart Biotech from bankruptcy with a big cash loan.  Dalton
obviously wanted this dinner to make the best possible impression on
her.

Lexy had helped Anne choose the wine and the menu.  Anne had suggested
they should try some German dish, in honor of the baroness, but Lexy
had vetoed the idea.  "Germans are not gourmets.  They eat cabbage,
potatoes, and a variety of vile sausages.

The menu has to be French."

In consultation with Amelia they settled on quenelles of pheasant with
morel sauce for the main course.  It was a daunting choice, given the
long preparation time required, and the difficulty of finding both
fresh pheasant and fresh morel mushrooms in the same season.  But
Amelia was enthusiastic.  For the wine, Lexy chose a great Rhone,
Beaucastel's Chateauneuf du Pape 1989.  For dessert they agreed on
something Amelia had found in an old French dessert cookbook--a rich,
complicated winter holiday cake made with hazelnuts, Swiss bittersweet
chocolate, and Dutch cocoa, called Gateau Castel Vallerien aux
Noisettes.

"If the baroness has any taste, Amelia will astonish her," Lexy said.

"If she doesn't, at least the rest of us will all know we've had a
great dinner."

Lexy had also helped Anne pick out a new evening gown for the occasion,
and Anne wished she'd hurry up and get here.

Anne slipped into the gown and fussed with it in front of her dressing
room mirror.  It was black, with long sleeves.  It was also cut very
low back and front, and decidedly clingy.  She had never worn anything
so daring before.  She would never have chosen it herself, but Lexy had
insisted.  It was a matter of association, Lexy had explained.  The
baroness naturally expected to be in glamorous company.

Anne picked out a long string of pearls and wQund them twice around her
neck.  She decided they called too much attention to her bosom.  She
tried half a dozen other necklaces.  None of them looked right.  Where
the hell was Lexy anyway?

The guest list was small--only a dozen--but Dalton had made sure it was
high-caliber: none of your boring local WASP gentry, jet-set riffraff,
or Wall Street types this time around.  Besides Lexy and a male friend,
Carlton Fisher, who was curator of antiquities for the Metropolitan
Museum of Art, there would be Henry Klein, secretary of state in the
last Republican administration, and his wife, Claudette, an imposing
social figure who sat on the boards of half a dozen cultural and
philanthropic organizations; Charles VanDamme, the president of
International Airlines, and his new wife, the famous actress Sylvia
Sanders.  And of course, Hank and Carol Ajemian.  Since the Baroness
was coming alone, the table was balanced by inviting an extra single
male--the Broadway producer and director Freddy Abbot.

Lexy finally breezed into the room, a full glass of white wine gripped
precariously between thumb and forefinger.  "Wow!"

That gown!"  she exclaimed.  "Fantastic."

"I'm scared to death.  What am I going to say to these people?

A secretary of state?  A German baroness?"

Lexy handed Anne her wineglass.  "Have a taste.  Settle your nerves."

Anne took two deep gulps.

"Hey, take it easy.  You don't want to pass out before the soup
course."

Lexy picked out a small gold necklace from the jewelry case on the
dresser and put it around Anne's neck.  "Black and gold.

You'll look like a goddess.  Now, two things: One, don't worry.

Two, don't try too hard to be amusing.  Just be yourself.  The men
aren't going to hear a word you say, anyway.  Just smile and ask a lot
of intimate questions.  Everybody loves intimate questions."

"I'm depending on you to keep things lively."

"It won't be necessary.  Tonight's crowd is strictly A-list.

They're all super-articulate egomaniacs.  You'll have to shout to make
yourself heard over the din.  It'll be the best dinner party you ever
had."  Lexy handed Anne a set of her gold earrings.

"Here, put these on.  That's all you need."

Anne stood in front of the mirror and adjusted the earrings.  "I have
great news," she said.  "Dalton finally said okay.  I'm going to have a
real job!"

"You're joking."

Anne squeezed Lexy's hand in glee.  "Biotech has a small research
facility half an hour away from here.  I'll have my own lab and two
assistants!  Isn't that great?"

Lexy laughed.  "Sounds like nepotism to me."

"Some friend you are."

"I'm happy for you, of course.  What'll you be doing?"

"Tell you more later," Anne promised.  "Go ahead down.  I've got to go
check on Genny."

Her daughter was in the nursery, eating dinner with Mrs. Callahan and
watching a videotape.

"Mommy, you look so pretty!"

Mrs. Callahan murmured her agreement, although Anne thought she seemed
a trifle shocked by the gown.  Anne gave Genny a quick hug.  "The
baroness wants to meet you," she said.

"I'll come up and get you in about half an hour.  Then you let Mrs.
Callahan put you right into bed, okay?"

"What's a baroness, Mommy?"

"It's a special name given only to very special ladies.  And I want you
to be very nice to her."

"Does she have any name besides baroness?"

"Yes, but you can call her baroness."

"Miss or Mrs.  Baroness?"

Anne and Mrs.  Callahan laughed.  "Just baroness," Anne said.

Anne arrived on the ground floor just in time to greet Carol and Hank
Ajemian.  She gave each of them a hug and hurried them into the
library, where Dalton was already engaged in a lively conversation with
Carlton Fisher and Freddy Abbot.

Henry and Claudette Klein arrived minutes later, with Charles VanDamme
and Sylvia Sanders right behind them.

Lexy's predictions were exactly right.  The guests crowded into the
library and within minutes all were talking at once.  The mood was
relaxed and jovial, almost boisterous--as if they were all old friends
who hadn't seen each other in ages.  Anne was showered with compliments
and was soon beaming.

Dalton came over.  "Everything okay?"

Anne squeezed his hand.  "Yes.  But where's the baroness?"

Dalton glanced at his watch.  "Good question."

"She hasn't called."

"It's begun to snow outside," Dalton said.  "Maybe that slowed them
down."

Another half-hour passed .  . . still no baroness.  The cook was
getting anxious, and the guests were beginning to expect dinner.

Anne went upstairs and told Mrs.  Callahan to put Genny to bed.

Ten minutes later the baroness arrived, chauffeur and bodyguard in
tow.

Dalton did the introductions in the library.

Anne found the woman intimidating.  She looked both regal and gorgeous,
like a movie star.  Her gown was subdued, but it complemented her
figure and complexion perfectly.  Her makeup was artfully invisible,
and every strand of her blond hair rested exactly in place.  She acted
as if she dressed this way every evening of her life.

The baroness seemed preoccupied.  She greeted everyone in the most
perfunctory manner and then stood aloof from the others, as if she
preferred not to talk with anyone.

The festive mood evaporated.  The guests began looking about awkwardly
and staring into their drinks.  The baroness hardly seemed the shy
type, Anne thought.  What was her problem?

Lexy came over.  "Don't worry.  A temporary lull.  A little culture
shock.  Things'll improve as soon as we get into dinner."

Dalton came by.  "Remember, the baroness wants to meet Genny."

"It's awfully late.  Is it that important?"

"Absolutely."

"All right.  I'll bring her down.  But just for a few minutes.

We've got to start dinner.  Amelia is about to start screaming and
throwing things."

Anne raced upstairs.  Genny was in bed but still awake.  "Would you
like to come downstairs to meet everybody?"

The little girl jumped up, immediately excited.

"Just for five minutes.  Then right back to bed."

"Okay.  Do I have to get dressed?"

"No.  We'll put on your bathrobe."

Genny clutched her stuffed animal.  "Can I take Rabbit?"

"Okay."

Anne guided Genny around the room and introduced her.  She was mildly
astonished at how the child poured on the charm.

Someone asked her how old she was, and there was a widespread
expression of disbelief when they learned she was just past two years
of age.

Anne introduced her to the baroness last.  Genny did a little curtsy
and said "Good evening, Baroness," in a very formal tone.

Everyone laughed.

The baroness smiled--the first time she had smiled since her arrival.

She came up close to Genny and bent down to take her hand.  Genny
backed away.  Her cheerfulness vanished, replaced by an expression of
wild-eyed fear.

The baroness stepped forward again, murmuring some endearment in
German.  Genny backed away again.  Panic lit her eyes.

She pressed her lips together as if she were about to burst into
tears.

Anne put a hand on her shoulder and pushed her gently toward the
baroness.

Genny exploded in a rage.  She twisted away from her mother and uttered
a high-pitched scream that froze everyone in place.

Anne caught her, but Genny punched her hard on the arms, twisted free
again, and ran from the room, wailing loudly.

Anne was dumbstruck.  The child had never done anything like this,
ever.  She caught up with her on the stairs and followed her into her
bedroom.

Dalton quickly escorted the guests into dinner.

Anne picked Genny up in her arms and rocked her gently.  She soon
calmed down.

"What's the matter, darling?"

Genny buried her face in her mother's shoulder.

"Did something scare you?"

"Baroness."

"She scared you?"

"Yes."

"But why?"

"She's bad.  I hate her."

Anne held her daughter in her arms for a few minutes, then tucked her
back in bed.  She fell asleep almost instantly.

Anne returned downstairs, wondering how she was going to explain
Genny's embarrassing behavior.  She could hear the baroness's voice as
she approached the dining room.  The shock of the incident with Genny
seemed to have jolted the woman out of her unsocial mood.  She was
laughing at a story Dalton was telling her.

Anne was relieved to see that everyone else at the table was chatting
amiably.  Lexy and Henry Klein were joking about some movie they had
seen recently.  Claudette Klein and Charles VanDamme were engaged in a
discussion about the new politics of Eastern Europe.  Freddy Abbot and
Sylvia Sanders were telling each other show business anecdotes.

Carlton Fisher and Carol Ajemian were talking about primitive art.

Anne sat down next to Hank Ajemian.

"Is Genny all right?"  he asked.

"She's fine," she replied in a low voice.  "But I'm so embarrassed.

She never behaves like that."

"What set her off?  Do you know?"

Anne hesitated, then spoke in a whisper only Ajemian could hear.  "She
doesn't like the baroness."

Ajemian stole a glance across the table and curled up his lip in a sly
smile.  "She has good judgment," he whispered back.  "Neither do I."

The quenelles of pheasant were perfectly prepared and elegantly
served.

Anne and Hank Ajemian talked about Goth and Coronado.

"My own gut instinct," Ajemian said, "is that Jupiter's a fraud.

I could be wrong.  But that's my feeling.  They're going to set up a
test program.  So we'll find out who's right."

"Why would Goth have tried to perpetrate a fraud?"

Ajemian cut into his pheasant with his fork.  "I don't know.  But
Dalton and I spent hours hunting through the hospital, through Goth's
apartment, and through that old medical school up on the hill, looking
for records.  We couldn't find anything."

"Couldn't everything have been destroyed in the fire?"

"Maybe.  But there ought to have been at least some traces of his work
around somewhere.  All we found were a couple of boxes of old bones,
some fetuses pickled in jars, and some old scientific journals.  But no
research.  No computer printouts, nothing."

After dessert the party moved into the library for coffee.  Anne
immediately went over to the baroness.  The woman smiled and
complimented Anne on the dinner.  As she spoke, her eyes appraised Anne
with a keen, feral hardness.  "You look quite lovely, Frau Stewart."

Anne blushed.  "Thank you.  Please call me Anne."

Her eyes explored the exposed swell of Anne's bosom.  "Your husband
never told me how beautiful you were."

Anne didn't know how to reply.  The tone in the woman's voice had an
insinuating, almost flirtatious quality to it.  If she had been a man,
Anne would have assumed she was making a pass.

"I'm very sorry about our daughter," Anne said.  "I don't know what got
into her.  She's usually so well-behaved."

"It's quite all right," the baroness purred.  "Perhaps I shall have
another opportunity.  Your husband has told me so much about her, you
know.  Naturally I wanted to see this extraordinary child for
myself."

"Fathers like to brag," Anne replied, forcing a smile.  "But it's true
that Genny is quite precocious...."

"I am so relieved to hear that."

The remark confused Anne.  "You are?"

"Of course.  And you should be congratulated.  Such a very brave
woman."

"Brave?"

The baroness laughed.  "Don't be so modest, Frau Stewart.  To be
willing to volunteer for such a procedure demanded great courage.  You
must have had to overcome many fears.  Many things could have gone
wrong, ja?"

"The procedure is actually pretty commonplace these days," Anne
replied, still puzzled.

The baroness ignored her reply.  "When I think of you and your daughter
I think of Mary and the Virgin Birth," she said, arching an eyebrow.

"And born exactly at the beginning of the third millennium.

Extraordinary.  Almost like the Second Coming.  Really quite
extraordinary.

Anne wrinkled her brow in complete bafflement.  "I'm sorry-I don't
think I know what you're talking about."

The baroness took a sip from her demitasse and placed it on a side
table.  "My dear," she said.  Her tone was patronizing.  "I'm talking
about Goth's procedure, of course.  The Jupiter program.

I know you've kept it a big secret but of course your husband had to
tell me about it to get my financial backing.  It was a very clever
idea.  Inspired."

Anne felt her pulse racing, but she still didn't quite get it.

"What was?"

The baroness waved a hand impatiently.  "Using you as the program's
guinea pig, of course."

Anne blinked.  She tried to say something but couldn't.  She suddenly
felt faint.  She managed a barely audible "Excuse me," then turned and
started out of the library.  Everything became a blur --the faces of
the guests, the sounds, the rooms, the furniture.

She found herself running upstairs.

Genny's door was open, and a night light burning.  Anne pressed herself
against the side of the crib and looked down at her sleeping
daughter.

She felt a wave of terror, then rage.  After a few minutes the narcotic
of psychological shock took hold and submerged her thoughts and
emotions in a kind of twilight numbness.

She pulled Genny from the crib and cradled her in her arms.

"My God, my God, what have they done to you?"

The little girl woke and stirred uncomfortably for a few moments, then
drifted back to sleep in her mother's arms.

Lexy appeared in the bedroom doorway.  "I saw you dash out," she
said.

"Are you all right?"

Anne squeezed Genny against her.  "No.  We're leaving."

"Say that again?"

"Genny and I are leaving."

Lexy threw up her arms in confusion.  "When?"

"Now."

"Why?  What's the matter?  Where are you going?"

"I can't explain.  Can we stay with you?"

"With me?  In the city?  Sure, I guess so, but--" "I want to leave
right now.  Get your car."

"Jesus, Annie, hold on a minute--" "Now.  Get your car.  We're leaving
right now.  Right now!"

6

It was two days before Anne could bring herself to speak to her
husband, even over the telephone.

Dalton Stewart begged, pleaded, cajoled, threatened.  He pointed out
again and again that she was being unfair.  His gamble with her
pregnancy had paid off, after all--paid off magnificently.

Genny was a beautiful, superior child.  "Goth was a genius," he
argued.

"He was going to do some genetic repairs anyway, to fix the fragile X
syndrome.  It was perfectly logical of him to ask if I might not want
to try the whole package.  There was hardly any risk.  He swore the
program would work.  You might have miscarried, that's all."

"He asked you?"

Dalton hesitated a moment.  "Look, Anne.  It seemed like a hell of a
good idea to me.  It was a good idea.  And there was never any real
threat to the baby."

"Are you trying to convince me of that, or yourself?"

"It's the truth!"

Anne once would have been eager to believe Dalton.  She had dreaded
arguments and confrontations ever since she was a little girl.  She
associated them with loss and abandonment.  A strong disagreement with
anybody always seemed to put the world in abrupt danger of falling
apart.  To protect herself, Anne had always believed the best in
people.  She would rather have something be her fault than have to
confront someone else.

But Dalton Stewart had deceived her about the one thing in her life
that he must have known mattered more to her than anything else--their
child.  He had manipulated her because he assumed he could get away
with it.  She despised him suddenly.  In his arrogant insensitivity he
had shown her just how unimportant she was in his scheme of things.

"Don't blow it all out of proportion," Dalton continued.  "Sure, I
admit I should have asked you.  I'm very sorry now that I didn't.

But I was afraid you might say no, because you wouldn't have understood
the facts of the situation.  Genetics is a complicated science.  I told
myself how happy you'd be when you gave birth to that perfect child.

And I thought that it was far better if you believed the reason for the
child's superiority was completely natural--that it all came from you
and me.... That way, you would always be so proud...."

The receiver, wet from the perspiration of her hand, kept slipping.

She clutched it tightly in her fist.  "Save your breath, Dalton.

I've already called a lawyer and asked him to arrange a legal
separation."

"Anne.  For godsakes listen to me.  Please.  Look at how it's all
turned out.  We've got the greatest little girl in the world.  Why
should you be upset by that?  Why do this to me?  And why do this to
Genny?  It's all working out.  Why do you want to ruin everything?"

Anne was unmoved.  Her husband didn't know that it had worked out at
all.  He didn't know what time bombs might lie dormant in Genny's
genes.  No one did.

"Please, Anne.  I love you.  I love Genny."  Dalton's voice cracked.

"I need you, Anne.  That's something I'd never have admitted to anyone
two years ago.  But it's true.  You've changed me.  Genny's changed
me.

For the first time in my life I felt happy."

"You only care about yourself, Dalton."

"Promise me you'll think about--" Anne hung up, cutting Dalton off in
mid-sentence.

She sat by the phone for several minutes, trying to regain her
composure.  She felt tremendous sadness.  But she didn't feel any
uncertainty- He had betrayed her in the most profound way.  It was over
with Dalton forever.

Later, Hank Ajemian called.  "God, I'm so sorry about what happened.

Carol and I are both upset as hell...."

Anne thanked him.

"I didn't know about it, Anne.  I swear I didn't.  Dalton didn't tell
anyone."

"He told the baroness."

"He needed to sell the program to her.  Stewart Biotech was facing
bankruptcy.  Bankruptcy would have been better, to tell you the
truth."

"Why?"

"The baroness will end up owning everything.  I know how she
operates.

She'll strip Dalton clean."

Anne asked Ajemian about the Jupiter program.  He described the
original meetings, and all he could remember about what Goth had said
the program would do.

"Goth's dead," Anne said.  "How can they even pretend to have any idea
of what they're doing?  It's dangerous to pursue it.  And immoral."

"Maybe you're right."

"Can you do anything to stop it?"

"No chance of that, Anne.  Dalton's betting the ranch on this one."

The following afternoon Anne got up her courage and took Genny to see
pediatrician Paul Elder.  They walked through Central Park from Lexy's
apartment to his office and sat in the waiting room for two and a half
hours.  At seven-thirty his last patient finally left and the doctor
appeared, apologizing for the long wait.

"I'm Anne Stewart.  This is my daughter, Genevieve."

Elder looked perplexed.  "You look familiar, but this little lady
doesn't.  The doctor bent down and held out his hand toward Anne's
daughter.  "Hello, Genevieve.  How are you?"

Genny held out her tiny hand for the doctor to shake.  "Very well,
thank you," she piped cheerfully.  "You can call me Genny."

"Okay, Genny.  You're very grown up, aren't you?  How old are you?"

"I was two on New Year's Day."

Elder straightened up, genuinely surprised.  "Is that all?"

"I was born with the century," Genny declared, with a proud grin.

"That's what Mommy says."

"Well, you certainly don't look like you need a doctor.  Are you
sick?"

Genny shook her head.  "I feel very well, thank you."

The doctor looked up at Genny's mother questioningly.

"I came to see you a little over two and a half years ago," Anne said,
suddenly acutely embarrassed.  "When I was pregnant.  I suppose you
don't remember.  I wanted you to be Genny's doctor...."

"Oh?"

"You didn't .  . ."  Anne swallowed her words.  She clenched her fists
and took a deep breath.  This time, she wasn't going to back down.

"You wouldn't take us on," she declared in a tight voice.

"You told me you didn't have time for me then, or words to that
effect.

I wouldn't have come back, but something's happened.  I'm very sorry to
burst in on you like this, but I wanted to make sure that you would see
us.  Right now, if possible.  It's important.  I really won't take no
for an answer this time.  Not at least until you've heard what I have
to say.  I--" Dr.  Elder rested a hand gently on Anne's shoulder.

"Relax," he said.

"Of course I'll look at her."

"There's a lot I have to explain first," Anne added, feeling
dangerously near tears.

The doctor nodded.  He reached for Genny's hand.  "We have lots of toys
over here in the corner, you know.  Would you like to play with them
while I talk to your mommy?"

Genny shook her head.  "I really don't like your toys very much," she
admitted.

"You don't?"

"But I like your doctor things.  Can I play with some of your doctor
things ?  " Elder grinned.  "You mean stethoscopes--things like
that?"

Genny laughed.  "I love stethoscopes!  They're my favorite!"

Dr. Elder found Genny a stethoscope, a tongue depressor, a knee
mallet, and a few other medical odds and ends and set her up with them
at his nurse's desk.  The nurse had gone home two hours ago.

Anne sat in a chair next to the doctor's cluttered desk and spilled out
her story in a torrent of words, describing the ZIFT fertilization
procedure, the traumatic circumstances of Genny's birth on New Year's
Eve, the explosions, the fire, Goth's death, and finally her discovery,
just three nights ago, that Goth had done more to Genny than simply
correct the gene carrying the fragile X syndrome.

"He used me as a guinea pig to test some kind of new genetic formula,"
Anne said, twisting her handbag strap nervously between her fingers.

"It was something that he had been working on that my husband was going
to help him develop."

"But why come to me?"

"Because I remember you said you knew about Goth's work."

"I knew something about him," he admitted.  "After medical school I
studied genetics.  I originally intended to specialize in it."

"Why'd you change your mind?"

"The genetics field was getting too commercial for my taste, for one
thing.  Private companies were buying up talent and slapping patents on
everything.  The researchers were losing control to the marketing
directors.  Genetics today is driven more by the desire for a quick
buck, I'm sorry to say, than by science.  I guess that accounts for my
earlier hostility to you.  I apologize.  But I don't entirely approve
of companies like Stewart Biotech, which I understand your husband
owns."

"And you no doubt think I've gotten just what I deserved.

But the truth is I had no idea at the time what Goth was going to do.

I wasn't told anything.  I know it was stupid of me, not to have been
more suspicious, but .  . ."  She paused, struggling to keep her
emotions in check.  "My God, I'm just so worried about what might
happen to Genny--what she might turn out to be...."

"Any cause for worry so far?"

"No.  She seems healthy and normal, thank God.  Exceptionally
precocious, however, if you'll excuse a mother's bragging."

"Has she been sick much?"

"Not even once.  She's yet to have a cold, a sore throat, an ear
infection.  Anything.  And she's been tested for everything
imaginable.

That was my husband's idea.  Now I know why.  I brought along her
medical records."

Anne pulled a thick folder from her bag and handed it to Elder.

He thumbed through it carefully.  He looked exactly as unkempt as Anne
had remembered him--frayed collar, wrinkled trousers, unruly hair.  She
found his total lack of physical vanity enormously appealing.  It
presumed an unselfish spirit--and a mind focused on more important
matters.

"It's impressive," he admitted, closing the folder and returning it to
her.  "No cause for alarm here.  And maybe there's no cause for alarm,
period."

"I want to believe that, but I don't dare," Anne said.

"Well, it's possible that Goth's genetic tinkering--assuming he did do
some--simply didn't accomplish anything.  She appears to be unusually
bright, but I'd guess she's within the normal range, as such things
go.

I've met some extraordinarily precocious children.  So her high
intelligence may be no more than one of nature's random lucky
combination of genes, without any credit to Goth at all."

"But she's barely past two.  I'm terrified what might show up next week
or next month.  Or next year."

Elder nodded sympathetically.  "I understand.  But a tremendous amount
of development has already taken place.  If there were any gross
physical or mental abnormalities, it's likely they'd have manifested
themselves by now."

They both turned to the doorway.  Genny was standing there, holding her
stuffed rabbit in her arms and listening to their conversation.  Elder
held out a hand.  "Come on in, Genny, and let me take a look at you, if
that's okay with you."

Genny climbed up on the examination table and Elder gave her a cursory
physical examination.

"Will you check Rabbit, too?"  she asked, holding up the stuffed animal
h "Sure.  Has he been sick, do you think?"

- "No, but he fell on his head."

"He did?  How did that happen?"

5 Genny pursed her lips thoughtfully.  "Well, I guess I dropped him.  I
didn't mean to, though."

,' "Let's take a look at the young fellow."

Genny handed the doctor her stuffed rabbit.  Elder made an energetic
pretense of examining it, much to Genny's delight.

Anne watched his performance with interest.  The doctor won Genny's
trust almost immediately.

They were having a very deep conversation about Rabbit.  "No concussion
from that fall," Elder declared, in a perfectly serious tone.  "But
that doesn't surprise me.  Unlike you and me, he's got a lot of fur,
and that helps protect him.  You can drop him all you like and it won't
bother him at all."

"You're nice," Genny observed.  "Especially for a doctor."

"Thank you.  You're pretty nice, too.  But do you really think doctors
aren't nice?"

Genny knitted her brow.  "Some of them aren't.  Some of them have a bad
color, too."

"Bad color?"

Genny sighed.  "Well, a funny color, anyway.  I don't know if it's
really bad.  You have a nice color."

"I do?  What color do I have?"

Genny giggled.  Her eyes strayed to the vicinity of Elder's hair and
ears.  "Don't you even know?"

"Gee, no, I don't."

Genny laughed with delight.  "Well, I think it's .  . . kinda blue."

"Blue?  I see."

"It's a little game she plays," Anne explained.  "Don't ask me where
she got the idea, but she's quite convinced that everybody has a
color."

Genny protested angrily.  "They do have colors, Mommy!  I'm not making
it up.  Honest!"

"I'm just trying to explain to Dr.  Elder."

Paul Elder stood silently for a moment, contemplating the little
girl.

He looked to Anne.  "Can I ask her a bit more about these colors?"

"I don't mind," Genny interjected.  "You can ask me anything you
want."

Anne laughed.  "There's your answer."

"Okay.  How about your mommy?  What color is she?"

Genny looked over at her mother with a sassy grin.  "Well, she was
kinda light blue.  But now she's kinda orange, too."

"Where do you see these colors on her?"

Genny drew her hand around her head.  "All around here.  Can't you see
them, too?"

"Nope.  I don't see any colors around her head at all."

Anne felt the doctor's eyes on her.  He was rather a shy man, she
thought, and that made the warmth of his gaze all the more
noticeable.

She became suddenly aware of her own heartbeat.

Genny was thoughtful.  "Well, I thought doctors probably could," she
announced.

"How about Rabbit?  What color is he?"

Genny shook her head emphatically.  "Stuffed animals don't have colors,
silly."

"No?"

"Only people.  And real animals."

"What about you?  What's your color?"

Genny chewed on her lower lip, mulling over the question.  "I don't
have one, either.  Well, I think I do, but I think I can't see it
because I have to look in the mirror, and the colors don't show up in a
mirror, you know.  But I bet if I could see myself for real, I could
see my color, too.  My nanny says I'm white, because I'm too young to
have any color, but I don't think she really sees anything.  I think
she just makes it up.  I think I'm the only one who sees them for
real.

Her color is orange--and yellow, sometimes."

"How about your dad?"

Genny drew in a big breath.  "His colors are dark, and sometimes I
can't tell what they are.  Sometimes he's kinda greenish blue, but then
he gets red sometimes, too.  Real red--just like the fireplace, when
the logs are all burned up and there's only some ... I forget what you
call them...."

"Embers?"

"Embers.  Daddy looks like embers, sometimes.  Especially when he's
mad.  Or when he's in a hurry.  Mommy says he's always in

' a hurry.

-g Paul Elder sneaked a look at Anne and smiled.  "Don't embarrass your
mommy.

"I'm used to it.  But I must say she doesn't usually ramble on like
this with strangers.

"Dr.  Elder's not a stranger, Mommy," Genny insisted.

Elder helped Genny down from the examination table.  He handed her his
otoscope and she looked into her rabbit's ears with it.

"Auras," Elder murmured, walking back to his desk.  "I believe your
daughter Genny can see auras."

He saw the expression of alarm on Anne's face and quickly reassured
her.  "She's not ill.  It's not that.  But it is unusual."

"What is it?  What does it mean?"

"She can see an aura of color around people's heads.  It sounds
farfetched, I know, but apparently some individuals have this
ability.

It's rare, but it does exist.  My grandmother had it.  People made fun
of her, so she didn't talk about it in public.  But there was no
question that she saw some kind of colored margin around most animate
objects.  I've since read up on the subject a bit.  No one's yet come
up with an accepted scientific explanation, but it's probable that
Genny sees some kind of emitted heat energy that's visible in a portion
of the electromagnetic spectrum that most of us are not sensitive
enough to perceive.  In any case, it's a genuine ability, and it's
perfectly harmless."  He grinned.  "I wish I could see auras.  It might
help me in my diagnoses."

Anne's earlier anxiety came flooding back.  "You think she's
psychic?"

"Some psychics do have this ability.  But my grandmother wasn't
psychic.

So, I don't know the answer."  Elder squeezed his lower lip
thoughtfully between thumb and forefinger.

"What surprises me most is that your daughter has this sensitivity at
such a young age.  That would seem very rare.  Fascinating."

Anne asked the obvious question: "Is it Goth's doing?"

Elder didn't deny the possibility.  He asked Anne for Genny's folder
and leafed through it again.  "This MRI she was given-when was it?"

"A year ago.  Just before her first birthday."

"I'm no expert at reading these things, but--would you object if I
arranged to give her another one?  They're expensive, of course, and
she's not ill, but if you really want me to pursue this matter .  .

."

"Oh yes, I do.  Please.  Anything you want to do.  I'd be so
grateful.

The cost won't matter."

"Okay.  I'll schedule her for one.  Also, I don't see any tests of her
general sensory acuteness here.  We might just test her eyes and
ears--see what they show."

"Whatever you think."

The doctor looked over in Genny's direction.  The little girl was busy
trying to wrap Rabbit's head in an elastic bandage.  "You mind if we do
some tests on you, Genny?"

Genny shook her head solemnly.  "I don't mind."

Elder looked back at Anne, bending forward in her chair.

"Look, this may all be quite fruitless, you realize.  I understand your
worry.  But from the look of things, you've got a perfectly normal
child.  A superior child, but a normal one."

"That's what my husband said.  That's what this program of Goth's is
all about.  Creating superior children.  They plan to start testing it
in Europe."

"They?"

Anne explained the business partnership that her husband and the
Baroness von Hauser had entered into to develop Jupiter.

Dr. Elder reacted sharply.  "I thought the program died with Harold
Goth?"

"No.  Dalton managed to keep a copy of it."

"What does your husband say?  It seems he should be a considerable help
here."

"I've left him."

"Because of this?"

"Yes."

"I see.  Do you know if he has any data from Goth's work?

Goth must have done experiments.

"I don't know."

; "What about the program itself?  Can we look at it?  It's likely to
be the only way we'll be able to determine what Goth actually - did to
Genny.  Short of just watching her grow up."

"It's locked up somewhere.  I doubt my husband would allow me to show
it to you.  He considers it a priceless company secret."

"That's too bad."

"I'll try to get it for you."

- Elder looked down at Genny speculatively.  "Okay.  In the meantime,
let's do those tests."

"What do you think?"  Dalton Stewart asked.

Hank Ajemian tightened his collar around his neck and looked out at the
snow-covered mountain ridges that fell away to the north and east.

"Nice view."

Dalton Stewart laughed.  "That all?"

Ajemian pulled a tissue from his pocket and sneezed into it.

"The only thing around here I'd call nice."

The two men were standing on the terrace of a fifty-room mansion, built
originally as a vacation retreat for the Romanian Communist despot
Nicolae Ceausescu and his wife, Elena.  The mansion, with its
surrounding three hundred acres of field and forest on the western
slopes of the Transylvanian Alps south of the city of Sibiu, now
belonged to the Baroness von Hauser, and it was bustling with
activity.

A staff of twenty-five geneticists, doctors, nurses, technicians, and
administrators had moved into the echoing stone-and-glass palace and
converted it into a laboratory and clinic where this final version of
Dr. Harold Goth's Jupiter program was at last to get its initial
trials.  The first half-dozen of twenty carefully screened local women
volunteers had arrived the day before.  Their genomes had been obtained
and analyzed, their eggs fertilized with their husbands' sperm in
vitro, and the zygotes altered genetically according to Jupiter's
blueprint.  Now they were ready for the ZIFT procedure--the delivery of
the altered eggs into their fallopian tubes.

238

"The middle of nowhere," Ajemian complained, surveying the surrounding
vistas of forest and mountain.

"It's perfect," Stewart replied.  "When we start bringing in paying
customers, they'll want a lot of privacy.  And the Romanians won't give
us any trouble.

"Sure.  The baroness bought off the whole Romanian government.  In the
long run, bribery's not a good policy.  When they inevitably throw
these bums out, she'll have to bribe a whole new bunch, or get thrown
out herself.

"You're too cynical, Hank.  If the pilot program's a success here, we
can always move the operation to another country."

"Sure.  And bribe everybody all over again?  How many countries will
allow it?  Not many."

"We only need one."

"There's something else that's been bothering me," Ajemian said,
swiping at his nose.  "Now that the baroness has a copy of Jupiter in
her possession, what's to prevent her cutting us out altogether?"

Stewart cast Ajemian a sharp, disapproving look.  "A legally binding
contract, for one thing."

"The baroness has a history of getting around legally binding
contracts."

Stewart shrugged.  "We've gotten around a few ourselves, Hank, if the
truth be told."

"They were her goons, New Year's Eve in Coronado," Ajemian said.

"What are you talking about?"

"She was after Jupiter.  She sent them to break into Goth's lab and
steal the program."

"I've thought of that.  But we have no proof.  It could have been
Yamamoto, Fairchild, Prince Bandar.  Even President Despres.

Even somebody we don't know."

Ajemian shook his head.  "It was the baroness."

"Even if it was, so what?"

"You can't trust her."

"We don't have to trust her," Stewart said.  "There's always some risk
in any cooperative venture.  And in this situation we didn't have any
other choice."

"We could have declared bankruptcy."

"That's not a choice.  Anyway, the baroness won't try to cut us out.

At least not at this stage."

"Why not?"

"She needs my daughter.  Until other children are born under Jupiter
and reach the age of three or so, Genny's the only living proof that
Jupiter works.  The baroness is well aware of that.  We have nothing to
worry about for several years."

Ajemian sighed.  He was exceedingly depressed by the re-entry of the
baroness into Dalton Stewart's life.  She had saved Biotech from
bankruptcy, but the price had been steep.  Ajemian was convinced that
she would not only steal Jupiter from them but end up taking Stewart
Biotech as well.

She seemed to have some kind of hold over Dalton that mystified him.

And it wasn't just financial.  Was she blackmailing him?

He didn't think so.  Nobody knew more of Dalton Stewart's dark secrets
than Ajemian.  He was practically the curator of the collection.  If
the baroness had tried blackmail, Stewart would certainly have told
him.

That left sex.

Ajemian couldn't understand the baroness's appeal.  Admittedly, she was
attractive, in a severe Teutonic way; but once the real personality
behind the facade began to emerge, Ajemian thought, any man in his
right mind would run for his life.

But Dalton wasn't exactly in his right mind these days.  Ajemian had
never seen him in more fragile shape emotionally.  Anne's leaving had
devastated him.  He had retreated deep back into his self-protective
shell.  Even Ajemian could no longer figure out what he was thinking
about.  And Dalton's behavior was becoming increasingly reckless and
self-destructive.

It was a shame.  Dalton had been doing so well.  His daughter had
opened up his eyes to a whole new way of looking at the world.

Suddenly he understood what love was all about.  His behavior had
improved dramatically.  A man who had been emotionally self-centered
all his life now knew what it meant to care about someone.

Then the baroness, with one well-placed bombshell at that Long Island
dinner party, had destroyed it all.

It was a damned shame, Ajemian thought.  For the first time in his
life, Dalton Stewart allows himself to feel something emotionally--and
it blows up in his face.

Of course it was Dalton's own fault.  He had been unthinkably
insensitive, not telling Anne what Goth was up to with Genny.  If he
had just explained it to her up front, she probably would have gone
along with it.  Anne was always eager to be agreeable.  But it was too
late.  The damage appeared to be permanent.  Despite his pleas, Anne
was unwilling to forgive him.  The marriage was over, and the chief
beneficiary of the breakup so far appeared to be the baroness.

Stewart was looking at him.  "I'm going to stay on here for a while,"
he said.  "I'm going back to Munich with the baroness tomorrow.  She's
giving me office space, and she's found me an apartment.  I want to
stay on top of Jupiter.  We can't afford to fuck this up a second
time."

"What about New York?"

"You're going to have to run things there for me for a while.

That okay?"

"Sure.  But Biotech's got a lot of problems."

"Between faxes and the phone, you can keep me up to speed."

"How long you plan to stay?"

"Probably until we get the first test group results."

Ajemian's jaw dropped.  "Nine months?"

Stewart looked at him steadily.  "I'll be back and forth."

The baroness appeared on the terrace, in the company of her creepy
personal assistant, Karla.

Where in hell did she find these people?  Ajemian wondered.

Everybody that worked for her was a little strange.  A process of
self-selection, Ajemian supposed.  She liked to surround herself with
weak, dependent types whose unquestioning loyalty she could command.

And that weird couple, Katrina and Aldous.

What was the story there?  He had thought at first that they were her
personal servants.  Now he was beginning to suspect that they might be
her lovers--both of them.

The baroness took Stewart by the arm and led him inside to meet Dr.
Laura Garhardt, the head of the resident medical and technical staff.

She ignored Ajemian completely, but Karla managed to throw him a nasty
over-the-shoulder glance as she followed the baroness and Stewart
inside.

The staffing for this new project was a case study of the baroness in
action.  Every single one of the twenty-five new employees were from
the baroness's companies in Europe.  Not one was from Biotech.  At
Ajemian's insistence, Stewart had offered his own slate of candidates,
ut the baroness had found reasons to object to all of them.  Stewart
hadn't put up much of an argument; he didn't seem to think it mattered
much, at this stage.  The whole program was an experiment, he had told
Ajemian, and most Biotech employees were understandably leery of
it--especially since the work they would be doing was patently illegal
in most countries.

So Stewart was perfectly content to let the baroness staff the place
entirely with her own people, even though it meant that his influence
on the project would be reduced to near zero at the very outset.  By
the time the place was ready to open for real customers, Dalton Stewart
would be watching from the sidelines.  And with the baroness's people
keeping the books as well, it was a given that she would cheat the
living hell out of him.

Ajemian had to do something.  He had been racking his brain for
months.

The woman's public image was so formidable she could get away with
anything.  She had frequently broken the law in her business
dealings--sometimes outrageously--and yet she had never suffered more
than an occasional slap on the wrist.  Her companies were known to be
flagrant polluters, yet not a single Hauser enterprise in Europe had
even been fined in the last five years.

Anyone who had the nerve to go against her always seemed to get
crushed.  Her political power in Germany was so great no one dared
touch her.  Even the muckraking left-wing press, a very active force in
the new Germany, shied away from her.

Ajemian had been using the Biotech research department to dig up all
the dirt on her it could find; but now that she was part of the
ownership, he had had to stop.  As it was, he lived in dread that she
might get wind of how much he had already done.  He had removed all the
files on her from the department and taken them home.  He had erased
all traces of the investigation from the computer banks and the backup
storage system as well.  And he had taken the additional precaution of
warning those who had been involved in the research that they would be
fired immediately if they ever so much as mentioned it to anyone.

Still, he worried.

And what had he uncovered?  The most damaging stuff had to do with the
right-wing political fringe in Germany.  Ajemian had discovered that
she was secretly bankrolling the neo-Nazi New Germany party, the ND.

Ajemian believed the baroness was also pouring money into similar
movements in Eastern Europe, where crime, economic hard times, and
political confusion made the right-wing message especially appealing.

If Jupiter proved to be a success, then a lot more money was going to
be siphoned off into these causes in the future.

Ajemian took one last look at the view.  The Transylvanian Alps.  The
location was quite appropriate, he thought: the estate of a dead
Romanian despot, located in Dracula's own backyard.

What did the baroness really want from Dalton?  he wondered.

It was hard to believe she was in love with him.

It must be Genny, Ajemian thought.  She was the key.  Stewart had said
as much himself: Genny proved the project worked.

But Anne was clearly determined to get full custody of Genny.

And meanwhile, she was doing her best to keep Genny away from Dalton as
much as possible.  And keeping her away from Dalton meant keeping her
away from the baroness.

Ajemian felt a sudden chill at the back of his neck.  How far might the
baroness go, he wondered, to make sure that she had access to Genny?

Lexy helped Anne solve her immediate practical needs.  She let her and
Genny stay in her large Manhattan apartment as long as Anne wanted, and
loaned her the money she needed until the separation papers were
finalized.

After a few weeks of adjustment, Anne began to enjoy her new
emancipation.  By March she had found her own apartment--a five-room
floor-through in an old brownstone on West Eleventh Street in Greenwich
Village.  Genny's nanny, Mrs. Callahan, moved in with them.  It was
cramped for three people, but Anne loved it.

Lexy began immediately bringing men around to meet Anne.

They invariably asked her out, and the results were invariably
disappointing, or worse.  Anne just wasn't interested in any of them,
and she quickly grew tired of fighting them off at the end of the
evening.

Her last date--a charming, boyishly handsome, and very rich Italian
playboy--was the last straw.

All evening he was the perfect gentleman--a little shallow, but still
fun to be with.  They had a good time.  Anne felt receptive.

At her front door, he asked to see her again, and she said yes.

Then he asked if he could come up to use the bathroom.  Anne showed him
the bathroom--off her bedroom at the back of the apartment.  When
fifteen minutes had passed and he hadn't come out, Anne went back to
check on him.  But he wasn't in the bath

244

1 room.  He was lying on her bed with all his clothes off, sporting a
big grin and an even bigger erection.

Anne wasn't amused.  She scooped his three-thousand-dollar suit and the
rest of his clothes up off the chair, tossed them out of the apartment,
and dialed 911.  He was out of the building, half-dressed, seconds
before the police arrived.

Anne called Lexy and told her to lay off for a while.  She just wasn't
interested in romance at the moment.

Her main concern was her daughter.

Dr. Elder promised her all the help with Genny he had time for, but
his office was always jammed with patients, and it was all he could do
to keep up.  His workday began at six in the morning, with hospital
rounds, and ended anywhere between seven and ten at night.  Part of
Sunday seemed to be the only time he took off.  Anne felt guilty
imposing on him, but she did it anyway.  It was part of her new
determination to be more assertive.

She also began the study of genetics.  She was astonished, and a little
discouraged, to discover how much genetics had advanced since she had
finished college.  Even with her background in the biological sciences,
she could make only minimal sense out of the latest books and articles
in the field.  She realized that to master the subject in any depth was
going to require an enormous amount of work.

Once or twice a week she would appear at Dr. Elder's office and make
herself helpful doing files, making appointments, and updating
charts.

Then, at the end of the day, she'd steal a few minutes to discuss Genny
and the subject of genetics.  Sometimes she'd bring Genny along, and
sometimes she'd bring Chinese takeout food and they'd have their
discussion over a makeshift dinner.

Elder enjoyed these breaks in his busy routine, and Anne felt
wonderfully comfortable with him.

Gennys medical history dominated their discussions.  The results of the
most recent tests were highly unusual.  The early testing, done when
Genny was an infant, had missed a great deal.

The technicians responsible had lacked the imagination to test the girl
for anything outside the most obvious medical categories Even at that,
the testers might have been suspicious of their results.  Elder had
never seen such perfect scores.  Genny was a model of robust health in
every respect.

The first MRI scan, done when Genny was a year old, might have caught
someone's attention, too, but whoever had viewed the results had missed
some minor anomalies.  Those were now more apparent in the second
scan.

Genny's brain-wave patterns appeared to be normal, except for one
curious thing.  The corpus callosum--that thick bundle of nerve-cell
strands that connects the right hemisphere of the brain with the
left--showed an unusually high degree of neurotransmitter activity.

The function of the corpus callosum was still not entirely understood,
but it was known to be the main communications link between the two
hemispheres.  Elder wasn't sure what the test results meant.  The
neurological specialists he had talked to weren't sure, either, but
several had speculated that the girl's brain might be processing a lot
more information than a normal brain.

This possibility was reinforced by Genny's scores on the WISC (Weschler
Intelligence Scale for Children), which Elder had persuaded a
psychologist friend to administer.  The psychologist had called Elder
immediately after scoring the tests to tell him that Genny was almost
off the scale.  The test showed an IQ near 200--the highest score he
had ever seen.

Elder tested Genny's hearing and vision himself, and the results
astounded him.  Genny could detect sound waves well below and well
above the normal range of the human ear.  And her sensitivity was so
great that she could detect a mere .02 decibel of sound-equivalent to
the sound of a coin dropped on cement from a hundred yards away.

Her vision was equally extraordinary.  She could resolve distant
objects with acuity approaching that of a hawk; and, even more
astonishing, she could see into both the infrared and the ultraviolet
ranges of the light spectrum--areas completely invisible to the human
eye without the use of special equipment.  Elder thought that this
probably explained the auras Genny said she .. .

;

saw around people's heads.  She could be seeing the individual's body
heat, which would register in the infrared range.

Elder had decided to let the remaining three senses--smell, touch, and
taste--go untested for the time being.  They were more difficult to
administer and score, especially with someone so young.  And it didn't
really matter.  He had more than enough to try to comprehend as it
was.

The doctor had also measured Genny's physical aptitude, and here he got
yet another shock.  At twenty-eight months, she possessed the muscular
strength and coordination of an eight-year-old boy.  He refused to
believe these results at first, because her musculature appeared to
have the normal tone and firmness for someone her age and size.  But he
had to accept the evidence of his own eyes.  Genny--who weighed thirty
pounds--could lift a forty-five-pound weight.

Elder told Anne that he no longer doubted that Genny Stewart's
extraordinary abilities were the result of Harold Goth's genetic
program.  But what completely mystified him was that even accepting a
thorough revamping of Genny's genes, these test results were still
impossible.  It was accepted theory in genetics that you could improve
someone's genes only up to the optimum limit found in the human
genome.

In other words, you could rearrange genetic code so that an individual
who would otherwise suffer from defective vision--myopia, for
example--would have perfect twenty-twenty sight.  But you could not
insert code into the genes that would give that person the eyes of a
hawk, or the ability to see into areas of the electromagnetic spectrum
clearly outside the range of the cones of the human eye, as it had
evolved over many thousands of years.  Yet Goth had somehow done it.

Elder gave Anne the names of several prominent geneticists who might be
able to give more complete help and advice than he could.  He also
urged her once again to bring him a copy of Goth's Jupiter program.

Without an understanding of how that worked, he explained, it was
doubtful that anyone would ever be able to understand Genny.  And
without that knowledge, it was impossible even to guess what might
happen to her as she matured.

Anne promised again that she would get the program, although she didn't
know how.  Dalton had already refused her, and Ajemian told her it was
impossible.  The few copies that existed were closely guarded.

Genny, meanwhile, continued to produce new surprises.

One evening, while rearranging some furniture in her bedroom, Anne had
bruised her shin on the sharp steel edge of the bed frame.  She sat
down on the bed and rolled up her jeans to examine the wound.  The spot
was swollen and sore and had begun to turn black and blue.  Genny
wandered in, dragging Rabbit.

"What's the matter, Mommy?"

"It's all right, darling.  I just bumped my leg."

"Can I make it better?"

Anne laughed and shook her head.  "No.  It'll be okay."

"But I want to, Mommy.  You always make my bumps better."

Anne pointed to the spot on her shin.  "Okay, little doctor.  It's all
yours."

Genny bent close to the bruised area, pressed her little hand against
it, and held it there.  Anne started.  Genny's palm was very warm.  She
could feel the heat from it spreading through her flesh.

The warmth was accompanied by a pulsing, tingling sensation, like a
mild electric current.  When Genny removed her hand, the tingling
sensation lingered.  The little girl looked slightly flushed, as if she
might have a fever.

"Do you feel all right, darling?"

Genny nodded and smiled.

"How did you make your hand so warm?"

"It's a secret," Genny said in a solemn tone.

"Give us a hint?"

"Well, I don't think I can."

"Have you done it before?"

"Well, just with my dolls, but that was only pretend.  I tried to put
my hand on Moby Cat where he hurt his leg, but he wouldn't hold
still."

Moby Cat was an overweight, lumbering, goodnatured Maine coon cat Genny
had acquired a year ago during a visit with her mother to the ASPCA.

1..

, Suddenly Genny announced that she was very sleepy.  Anne carried her
into her bed.  She put her head down on her pillow and ' fell instantly
into a deep sleep.

Anne noticed that the bruised spot on her leg no longer throbbed.  An
hour later both the swelling and the discoloration

1 had disappeared.  There was no tenderness in the area, no trace of
the injury whatsoever.  Normally she'd have expected to have a visible
bruise for a week.  She wanted to call Dr. Elder but lies itated; he
might think she was getting a little carried away.  She called Lexy
instead.

"Psychic healing," Lexy announced.  "Must be.  Fits right in ~; with
the auras.  Let's face it, your daughter must have psychic powers.

Maybe extraordinary psychic powers."

"I don't believe in them," Anne declared.

"No?  How do you explain what just happened to you?"

"I can't.  But there must be a better explanation than psychic
healing.

"More plausible one, you mean?"

"Yes."

Lexy laughed.  "Ask your favorite doctor.  See what he says."

"I don't dare.  He'll laugh at me."

Lexy began researching the subject of psychic phenomena for Anne, and
in the weeks that followed they discussed--or argued --the matter
frequently.  Anne finally brought it up with Paul Elder.

"I don't know," he said.  "I don't rule out anything.  It could well be
that by enhancing the senses genetically Goth may have stumbled across
the threshold of the psychic realm.  The whole subject of extrasensory
perception is an enigma.  Genny may give us some new insight into
it."

"Do you believe it exists or not?"  Anne persisted.

Elder smiled.  "You won't let me weasel my way out of anything, will
you?"

Anne smiled back.  She was beginning to like this man very much.

"Don't like to be pinned down, huh?"

"Well, I don't mind being pinned down by you," he confessed.

Anne laughed.  Elder flushed with embarrassment at his words.

"Get me a copy of Jupiter," he said, recovering himself.  "Then we'll
find the answer."

Joe Cooper called the special number and waited for the call back.

When it came, he felt a powerful urge not to answer the phone.

He was sick of this business.  It threatened to go on forever.  He
hated New York City, and he hated working in a hotel kitchen.

He wanted to be reassigned.  He sighed and lifted the receiver.

The scrambling devices used to make the line secure made Roy's voice on
the other end sound disembodied and distant.

"Cooper?"

Speaking."

"Time to set up a new surveillance."

"Who ?  " "Anne Stewart and her daughter."

"Address ?  " "A brownstone at 272 West Eleventh Street.  She's on the
second floor."

"Got it."

"Around the clock."

"I'll need help, then."

"I'll give you two men."

"Visual surveillance only?"

"No.  Sound too."

"I'll need at least five men."

Roy was silent for a moment, apparently debating with himself whether
the assignment merited such a expenditure of manpower.

"Five men, then," he said, finally.

"Trained men," Cooper added.  "Five trained men."

"Of course.  Five trained men."

Some time in the spring, Anne began to suspect that people were
watching her.

One day she noticed the same man three different times at three
different places.  First, he was leaning on the rail next to Genny at
the polar bear enclosure at the Central Park Zoo; then he was a counter
away from her at Bloomingdale's.  She spotted him the last time outside
a restaurant on Perry Street in Greenwich Village where she and Lexy
had gone for dinner.  Twice might have been a coincidence, but three
times?  The next day he was gone.

A few days later, someone else seemed to be following her, but she
couldn't be sure.  The next several weeks produced similar episodes.

No rational pattern emerged.  There was never anyone loitering on the
street near her building, for example.  Mostly it was just this feeling
she had of being watched.

Lexy was dubious, but suggested that Dalton might be responsible.  With
a divorce in the works, his lawyers could have hired private detectives
to snoop on her, hoping to prove adultery.

"Why would he bother?"

"Maybe he wants permanent custody of Genny."

The possibility of losing Genny in a divorce settlement had never
occurred to Anne.  She immediately asked her lawyer to find out what
was going on.  He called Dalton's lawyers.  They swore that they had
not hired anyone to tail her.  Anne didn't know what to think.  If it
wasn't Dalton, who could it be?

Or was she just imagining it?  Paul Elder thought so.

The evidence remained inconclusive.  No one ever approached her or
threatened her.  There were no strange telephone calls, no anonymous
letters in the mail.  And most days passed without any hint at all that
she might be under surveillance.  Other days she could swear there were
several people following her.

At first Anne refused to change her routines.  The streets of the West
Village were generally friendly, nonthreatening places, and she didn't
want to give in to whatever invisible force was trying to unnerve
her.

But finally, to preserve her rapidly disintegrating peace of mind, Anne
stopped going out by herself after dark-even to run an errand to the
corner convenience store.  And she made sure that her daughter was
never left alone.  She moved Genny into her own bedroom and let Mrs.
Callahan have the second bedroom to herself.

The separation agreement allowed Dalton to see Genny on weekends.  He
usually took her to Long Island; but since he was frequently away on
business trips, Genny was so far averaging only a day or two a month at
the North Shore estate, and Anne made certain that Mrs. Callahan was
with her when she couldn't be.

What else could she do about the situation?

Not much, she decided.  Except to be vigilant.

..

' .

"God, I'm nervous," Lexy Tate said, plucking at her blouse with her
fingers.  "Look at me.  I'm sweating.  Are you sure we have to do
this?"

Anne pressed a finger to her lips and pointed at the cab driver.

Lexy laughed.  "Are you kidding?  He can't understand a word.

It's a city ordinance--no English-speaking cabbies allowed.  Look at
the name on his license.  Ten consonants and no vowels."  Lexy bent
forward and addressed the driver in a loud voice.  "Hey, cabbie.  Would
you mind sticking your finger in your nose for my friend here?"

The cab driver glanced in his rearview mirror with a big grin.

"Okay!"  he replied.

"And then put it in your mouth.  Okay?"

"Okay!"

Lexy fell back against the seat, giggling uncontrollably.

Anne shook her head in disgust.  "You're such a teenager sometimes.  I
swear to God."

Lexy choked back the rest of her laughter.  "I'm just trying to ease
the tension.  I'm a nervous wreck.  I don't know why I agreed to do
this.  I love thrills, but this is crazy."

Anne was just as nervous, but she was determined to go through with
it.

"What if we get caught?"  Lexy demanded, for the tenth time.

"We won't get caught."

"Well, just hypothetically.  What could we be charged with?"

253

"I really don't know.  Don't think about it."

Lexy shifted nervously on the seat.  "Trespassing--if they catch us
before we take anything.  And breaking and entering.  But if they catch
us after, it's theft.  Grand theft, I think.  Or does that just apply
to autos?  As in grand theft auto?  Fuck, I don't know.

I've never heard of petty theft.  Have you?"

"No.  Stop talking about it."

"I guess there isn't any such thing.  Anyway, it's not armed robbery,
because we're not armed.  Burglary--that's what it is.

And that's a felony.  We could go to jail.  Jesus--strip searches .

forced lesbian sex .  . . badly prepared food.  I don't know if l could
stand it."

Anne pounded Lexy's knee with her fist.  "Lexy, we're not even going to
take anything.  Now, for godsakes, shut up!"

Lexy slumped back against the seat.  "I'm sorry.  I babble when I'm
nervous.  Anyway, I know a hell of a good criminal lawyer.

And he owes me."

"There's nothing to worry about," Anne replied in a harsh whisper.

"Are we doing all this for that doctor of yours?"

"We're doing it for Genny."

"Just because that doctor said you should?  You trust him that much?"

"He didn't tell me to.  It's my own idea."

"Why the hell doesn't 7e go with you?"

"Be sensible."

"You know what?  I think you're in love with the guy."

Anne felt her face flush.

"You talk about him all the time--Dr. X says do this, Dr. X says do
that.  Haven't you noticed?"

"Dr.  Elder.  Stop pretending you don't know his name."

"How about sexy?  Is he good-looking at all?"

Anne gazed out the window at Fifth Avenue.  They were just passing
Forty-second Street.  "Eight more blocks," she said.

Lexy repeated her question.

"Yes.  No.  I don't know.  He's tall and kind of rumpled and shaggy.

And he's great with Genny.  They really hit it off."

"How old is he?"

"I don't know.

"You must have some idea.  Twenty-two?  Seventy-three?"

"Fortyish."

"Single?"

"Yes."

"Probably gay, then."

"He's not gay!"

"How do you know?"

"My God, you're a pest tonight!"

Lexy remained silent for several blocks.

k;- "It still puts me in a rage, every time I think about it," Anne
burst out.  "Using me as a guinea pig, playing games with Genny's k
life.  I can't understand that kind of thinking."

"Dalton was thinking about his favorite subject--money."

"I don't know why I married him.  I don't know why I do anything
anymore.  I wake up now wondering if I really have any idea of what I
want out of life.  Or even if I know who I am."

"We're all entitled to a mistake or two, Annie.  Hell, I've made
thousands.  God hasn't struck me down yet.  Although He may well decide
to tonight."

Anne continued on her own line of thought.  "I would've forgiven Dalton
almost anything before I'd ever have thought of leaving him.

Especially since Genny's birth.  He really seemed to have changed.  But
I feel so damned betrayed."

"You deserve much better than Dalton.  I've always thought that.  We'll
find you an available duke or a count somewhere-some dashing European
with a country estate outside Paris, a chalet in St. Moritz, and a
villa in Juan-les-Pins, so I can visit you year round."

"No more of your dashing anythings.  That phony Italian count of yours
was the limit."

"You have to give him some points for style.  I mean, suddenly there he
is, stark naked on your bed, with a hard-on.  Every girl's fantasy."

"It was insulting."

"I'd have jumped right on and screwed his brains out."

"Not my style, I'm afraid.  And I'm not the type to have affairs,
anyway.  I couldn't handle it.  Especially now, with Genny."

"What are your plans?  To become a piano-playing nun?"

"We're here."

The taxi let them out at the corner of Fifth Avenue and Thirtyfourth
Street.  It was a chilly spring night.  A strong wind gusted down the
canyonlike avenue, adding to the discomfort.

"Let's get inside!"  Lexy gasped.  "I'm freezing."

They hurried down the Avenue to a big office building in the middle of
the block and went inside.  It was just past one o'clock in the
morning, and the guard at the front security desk, a solemn black man
in his sixties, looked up in surprise as the two women came bustling
in.  "You ladies working this late?"

Lexy took charge.  "Never on your life," she shot back.  "We've been
partying.  Just stopped by to pick up something very important my
friend here left in her desk."  Lexy gave the guard a big
conspiratorial wink.

The security guard shrugged, completely puzzled.  "Sign in here," he
said, pushing an open ledger across the desk.  A cheap ballpoint was
attached to the sign-in book by a partly unraveled length of string.

Lexy quickly scribbled "Gertrude Stein" and "Alice B. Toklas" in the
column labeled "Name."  In the "Company" column she wrote
"Macro-peripherals, Inc."; in the "Time In" column, "1:10."

"I'll have to look in your bags," the guard said in a weary voice.

Lexy dropped her thousand-dollar designer pocketbook onto the desk and
snapped it open.  The guard stirred the contents languidly with a
forefinger, then nodded.

"I thought you were just supposed to go through stuff on the way
out?"

Lexy said.

The man rolled his eyes in bored resignation.  "How do I know what you
might be taking out if I don't see what you're bringing in?"

Lexy gave him a toothy grin.  "Good point, sir."

Anne settled her large leather handbag on the desk and undid the
strap.

The guard stuck a hand in, felt around, and pulled out a black plastic
removable cartridge disk, about the size of a paperback book.  "What's
this thingamajig?"  he asked.

Anne started to slammer something.  Lexy cut in briskly: "It's her
homework--what do you think it is?"

"Homework," the guard repeated, turning the RCD over in his hand.

"It's the computer storage disk from her work station.  She takes it
home every night.  Boss's orders."

The guard turned the disk over one more time, then dropped it back into
Anne's bag.

"Hey, be careful with that!"  Lexy cried.  "There's very valuable data
on it.  If you damaged it, by God .  . ."

The guard held up a palm.  "Take it easy, ladies."

Anne and Lexy strode swiftly past the security desk to the elevator
banks.

"I didn't expect him to pull that cartridge right out of my handbag,"
Anne said, as the elevator door closed behind them.  "I nearly
fainted."

"It's just as well.  Now he'll expect to see it in your purse when we
come back down."

They got off on the thirtieth floor, where the executive offices of
Stewart Biotech were located.

The doors on both sides of the elevator banks were locked, but Anne had
a key.  Dalton had given it to her more than two years ago, so she
could meet him there when he was working late.  She had used it only
once.

Dalton's office was locked as well.

"Now what?"  Lexy asked.

"Hank Ajemian keeps an extra key in his desk."

"Suppose his office is locked?"

"It will be.  But Hank is always forgetting his keys, so his secretary
keeps an extra one in her desk drawer for him."

Anne unlocked Dalton's office with the key from Ajemian's desk and
turned on the switch by the door.  The room came alive with a muted
glow.  It was an unusually large space, with Oriental carpeting,
antique furnishings, and expensive art hanging on mahogany-paneled
walls.  The two outside corner walls were glass.  Beyond, the New York
skyline shimmered in the night, a breathtakingly romantic panorama of
bridges, skyscrapers, and street traffic.

"How about this," Lexy purred.  "I should have known he'd have the most
pretentiously upscale office in the city."

Anne locked the office door behind them and moved behind Dalton's
desk.

It was an old-fashioned banker's model, its cherry wood polished to a
lustrously deep brownish-red sheen.  A photograph of Genny, taken by
the pool garden when she was a year and a half, sat at one corner, near
the telephone console.  Anne saw it and felt her anger return.  She
groped with her fingers along the right inner side of the knee well,
found the button, and pushed it.

Across the room, a three-foot-wide hinged section of the bookcase that
lined the inner wall swung out silently like a door.  Behind it was a
small safe, embedded in the thick concrete-and-steel inner core of the
building.  It was designed to withstand almost any conceivable
assault--acid, lock picking, acetylene torch, or high explosives.

Only Dalton Stewart and Hank Ajemian knew the combination to the safe's
electronically controlled locking system, but Anne was confident she
could figure it out.  Dalton was very superstitious about
numbers--particularly the number 51371.  It represented the date--May
13, 1971--that his father had gone off to prison.  He always used it.

Every PIN number of every joint account and charge card they had shared
had used that same number.  Whether he did it out of some kind of
masochism, or ritual of revenge or atonement, she didn't know.

Whatever his reasons, she was sure he would have used the same number
for the safe's combination, and she was right.  As soon as she punched
in 51371, the safe door clicked open.

Anne pulled the door back with trembling fingers.  If someone should
walk in now, there would be no explaining their presence.

The thick steel door swung open easily.  Inside, on a series of small
shelves, sat stacks of documents--colored folders, contracts, company
documents, secret intelligence reports, notebooks, computer printouts,
a thick black ledger with several rubber bands wrapped around it, and
other odds and ends, including several thousand dollars in cash.

Anne sorted impatiently through the piles several times.  Lexy looked
over her shoulder.  "Find it yet?"

"No."

Lexy sifted through the material in the safe herself.  "Jesus, Anne,
it's not here."

_F "It has to be."

: .

.

"It ought to be pretty easy to see it, then.  Who told you it was
here?"

Anne slammed the safe door shut.  "Hank Ajemian."

"Would he lie to you?"

"No.  He even told me the cartridge type and size."

"Did you tell him you were going to try to steal it?"

"Copy it.  Of course not."

"Then Dalton must have moved it."

They stood looking at each other in the middle of the big office.

"Any idea where else he would put it?"  Lexy asked.

Anne shook her head.  After all the tension and the effort, the failure
to find it made her numb.

She decided to take one more look.  She redialed the combination,
pulled the door open, removed all the contents, and went through them
one at a time, repositioning each item back in its place after she had
examined it.  The ledger book wrapped with rubber bands was last.  She
peeled off the bands and opened it.

"Look."

Inside the ledger, neatly tucked into a rectangular recess cut through
the middle of the book's pages, was a black plastic RCD.

A gummed label on its surface identified it as Jupiter.

"How quaint," Lexy said.  "The old Agatha Christie hollowedout-book
trick."

Anne slipped the Jupiter cassette into her purse with the blank one she
had brought, and the two of them went out to the rows of secretaries
desks, looking for a computer.

Every desk had one, but none of them was configured to accept this
particular kind of RCD.

"Great," Anne said.  "We can't copy it."

"What do we do?"

"Take it with us.  I'll find a way to copy it, then return it."

Lexy threw up her hands in distress.  "Oh my God.  You mean we'd have
to come back?"

"What else can we do?  I've got to have it."

"We can leave the blank one here in its place.  Then you don't have to
come back."

"Why?"

"They have copies in Munich, or wherever they're doing the actual work
on this thing.  So they don't need this one at all.  It's only a
backup.  Like the original negative of a movie.  They store it and work
from dupes.  This'll probably sit here for years, untouched."

"I'd rather put the original back."

"Okay.  But leave the blank one here, anyway, for the time being.  You
don't want to have to explain to the guard downstairs why you came in
with one RCD and are leaving with two."

"That's true."

Anne substituted the blank RCD for the real one in the hollowed-out
space in the ledger book, wrote "Jupiter" on its label, wrapped the
rubber bands around it again, tucked it under the pile of documents on
the bottom shelf, and locked the safe again.

She slipped the Jupiter RCD into her leather bag, swung the hinged
bookshelf back down into position in front of the safe, replaced the
office door keys in their proper desks, and hurried out, with Lexy
close behind her.

When the elevator doors opened at the ground floor, four armed men in
uniform were standing there waiting for them.  The patches on their
sleeves indicated that they were employees of something called
Protectall Security Services.

Anne and Lexy stood in the elevator, paralyzed and speechless.

The door started to close again.  One of the guards jumped forward and
stuck his foot in the way.  He waved his pistol at them.

"Come on out, girls.  Over to that wall over there."

They grabbed the women and led them over to the section of wall at the
back end of the elevator bank.  One guard, flourishing a two-way radio,
ordered them to leave their bags on the floor.

They obeyed.

"Now stand facing the wall.  Put your hands on the wall."

Anne stole a sideways glance at her friend.  Lexy's face looked the way
Anne felt--terrified.  God, why had she done this?  And why had she
dragged Lexy into it?

She heard the guards talking.  They were trying to decide who should
frisk them.  They were mumbling, and Anne couldn't make out much of
what they were saying.

The night security man who had checked them in suddenly appeared,
carrying the sign-in sheet with him.

"These the ones?"  someone asked him.

"Yessir.  Those're the ones all right."  He handed the sheet to the
guard with the radio.

"One of you girls Gertrude Stein?"

"That's me, Officer," Anne said, surprised at her own boldness.

"And Alice B. Toklas?"

"She's Alice.  What's this all about?"

"There may have been a robbery in the building," he said.

"We're going to have to frisk you ladies."

"We're not armed, Officer," Anne said.

"We're gonna have to frisk you anyway."

The guard in charge--the name on his lapel ID was Don Martin--handed
his radio to one of the other men.  He had decided to reserve the
responsibility of the frisk for himself.  He walked over to Lexy first
and put a hand on her shoulder from behind.

"Have to ask you to spread your legs, Alice."

Anne, her hands still planted against the cold marble wall, looked
across at Lexy again.  Lexy winked back.  Martin, a tall, very muscular
white male with unkempt blond hair that curled out below his uniform
cap, ran his hands quickly up and down Lexy's sides, under her arms,
and around her waist.  He then bent down and slipped both hands up each
leg in turn, stopping a considerate inch or two short of her crotch.

He moved over to Anne.  One of his men laughed.  "It's a tough job, but
somebody's gotta do it, right, boss?"

"Shut up, Darrell."

Martin's frisk of Anne was much more thorough.  He slid both hands over
her breasts from behind, cupping and squeezing them in his big hands,
and then pinching her nipples between his thumb and forefinger.  Anne
stared at the wall and didn't move.  She could smell rum and tobacco on
his breath.

Martin knelt down and ran his hand up one leg.  Anne closed her eyes
and gritted her teeth.  Why hadn't she had the sense to wear jeans,
like Lexy, instead of a damned skirt?

She felt his hands exploring up along her thigh.  It was all she could
do to stand still.  She could hear the men behind them snickering.

Martin ran one hand slowly over her buttocks and began a leisurely
stroking of her pubic bone with the other.

She felt his fingers tugging at the crotch of her panties, trying to
insinuate themselves inside.  She was about to scream when one of the
other guards protested that he was taking too much time.

Martin reluctantly ended his frisk.

"Look through their handbags, Darrell," he said.

"I did already.  Nothing there."

"You check with the night man?"

The night man, standing right there, answered.  "Yeah, I looked too.

That's what they brought in."

Martin turned to a fifth security guard, just coming off the
elevator.

"What about the safe, Bill?"

"It was locked."

"Any signs of forced entry?"

"Not that I could see.  nothing missing, I guess.

Martin exhaled loudly, showing his displeasure.  "What're you girls
doin' here, middle of the night?"

"We just came in to get something from Gertie's desk," Lexy explained
in a chirpy voice.

"You work here?  In the building?"

"Yes sir.  Macro-peripherals, Inc.  We both work on software design.

You know, for computer programs and related .  . .

computer-assisted peripheral kinds of things."

"Yeah.  Well, the alarm went off down in our office for Stewart

''

-.

, .

b Y.

s..:

Biotech, up on the thirtieth floor.  You girls know anything about
D,.

that?

"No sir," Lexy replied.  "Never heard of it."

The guards stood around for a little while longer, talking in low
voices.  Lexy and Anne remained with their hands against the wall.

, "Can we go now?"  Anne demanded.

I "Yeah.  I guess it was a false alarm.  But hey, if we need to get in
touch with you--" "Just call Macro-peripherals," Anne snapped.

"Yeah.  Okay."  Martin eyed Anne up and down with a knowing grin.

"Hey, next time I might not let you off so easy."

Lexy picked up their handbags from the floor.  "And next time, bozo,
we'll report your behavior to Stewart Biotech and to your boss," she
said.

Anne grabbed her friend's arm and steered her toward the front exit.

"Never mind, Alice.  Never mind."

Out on Fifth Avenue, they dashed to the curb to hail a cab.

Lexy pulled up her fur collar.  "Jesus Christ, I never thought about
triggering a remote burglar alarm system.  And I thought for sure
they'd check out our IDs.  That was a close call."

"I'm sorry I got you into this," Anne said.

"Are you kidding?  We pulled it off, didn't we?  And you were great!

Sorry you got molested like that, though.  That Martin bastard barely
felt me up at all.  That really pissed me off."

Ambassador Mishima accepted the applause with a bow and a
self-deprecating smile.  "I welcome you to the glamorous metropolis of
Mikasa," he said.

Appreciative laughter rippled through the room.  Mikasa was anything
but a metropolis.  It was an isolated mountain village, a few
kilometers inland from the small city of Sapporo, on Japan's northern
island of Hokkaido.

His audience, twenty-five men and twenty women, was gathered in a
conference room on the second floor of a new building that housed the
most modern genetic research facility in the world.  Beyond the tightly
drawn window blinds of the laboratory building were clusters of
cottages and dormitorylike structures and a small pedestrian square
with a variety of shops and stores, all spread out in a park-like
setting of trees, lawns, and gardens.

These buildings had all once been part of the Olympic Village, built to
house the athletes at the 1972 Winter Games in Sapporo.

Only the laboratory building was new--that and the double rows of
high-security cyclone fencing that now encircled the entire village,
separating it from the outside world.

The forty-five individuals in the audience had been carefully selected
by a special government committee appointed by the prime minister.

They were among the very best microbiologists and geneticists in the
nation.  Together with a staff of several hundred technicians and
support personnel, they would live and work in the self-contained
isolation of this village for an undetermined

264

length of time.  Contact with the outside world would be severely
limited and carefully monitored.

All the participants had volunteered for the project--not just because
the pay and the benefits were extraordinary but because serving in the
project had been presented to them as a matter of patriotic duty.

There was a third attraction.  Although no one yet knew the details of
the project, the word was out in Japanese scientific and academic
circles that it was to be on the cutting edge of bioge netics.  Working
on the project would almost guarantee its participants extraordinary
professional and academic stature--and a

1- very secure future.

,u Today, they were to be formally introduced to their work.

Ambassador Mishima coughed gently and began the introduction.  He
pressed a button on the remote-control unit in his hand, '; and on a
big screen at the front of the room there appeared two black-and-white
photographs of an old automobile--a front view and a side view.

"Does anyone know what this is?"  he asked.

After a puzzled silence, a young man at the back of the room raised his
hand.  "It's an American automobile," he said.  "A Ford sedan.

Nineteen fifty-one, I believe."

Mishima grinned.  "Your father must have been in the auto business."

"No.  But I was a teenage car nut."

The others laughed and applauded.

"Well, my teenage car nut, your answer was very good, but it was also
wrong.  The car you see up there on the screen certainly does resemble
an American Ford four-door sedan, manufactured in Detroit in 1951.  But
in fact, this automobile was built in Osaka, Japan, in the year
1952."

Mishima paused to let the surprise sink in, then continued.  "Of all
the autos ever built in our country, this one is perhaps the most
important--because it was assembled in a very unusual manner.  In a
project sponsored by our government, a dozen American Fords were
purchased anonymously in the U.S imported to Japan, and brought to a
small shop outside Osaka.  At the shop a trained crew of industrial
technicians dismantled the autos piece by piece and examined them
exhaustively.  Every part was tested, weighed, measured, photographed,
and analyzed.

When the technicians had learned everything they could, they put the
cars back together again.  Then they tore them apart again, and put
them back together again.  They repeated this process over and over,
until they knew how to assemble a Ford sedan in their sleep."

Mishima observed his audience closely as he talked.  The tense,
concentrated expressions on their faces told him that they were trying
very hard to anticipate what possible connection his tale could have to
their present circumstances.  He was happy that they were so
attentive--and so mystified.

"These men then built their own automobile," he continued.

"It was identical to the car they had so thoroughly studied.  Building
it was a very difficult task, because in our country at that time there
did not exist the specialized and sophisticated machine tools and dies
necessary to manufacture such a product.  In 1951 we were a long way
from state of the art in any endeavor, but particularly in
automobiles.

All our factories had been destroyed by the bombing.  So before these
men could make this Ford, they had first to invent the tools to do
it.

It took them an entire year, but they ultimately succeeded.  And there,
in those photographs, is the fruit of their labor.  It looked like a
Ford, it drove like a Ford, but it was not a Ford.  It was a Japanese
copy of a Ford."

Mishima watched the faces.  He saw they were beginning to get the
point.

"Well, not quite exact," he continued.  "The Japanese Ford got five
miles more to the gallon, generated more horsepower, had better brakes,
a smoother shifting mechanism, a more reliable engine, better bumpers,
and a more stable suspension system.  The shop in Osaka made only that
one copy.  Because, of course, they could not mass-produce something so
obviously stolen from an American design.  No, they did something much
better.  They took their experience and went out to design and
manufacture automobiles for Toyota, Honda, Mitsubishi, Subaru, and
Nissan."

His listeners had become very quiet, hanging on every word.

Mishima beamed self-consciously and went on.

"Those of you in this room today are faced with a very similar
challenge- Instead of a Ford sedan to learn from, you will have the
complete computer printouts of three human genomes, obtained from hair
samples.  One comes from a man, another from a woman, and a third from
their young child.  In this instance, the child is the 1951 Ford.  Your
task will be to construct the computer program that will duplicate her
genome under the same set of circumstances.  Your task is far more
difficult than that faced by the men who copied that old Ford.  The
technologies involved are thousands of times more complex.  But in many
ways your task is similar.  You will be given a product--the girl's
genome--to take apart and analyze.  And from that analysis, you will
work backwards--you will endeavor to reconstruct, by crossreferencing
the girl's genome with those of her parents, a copy of the same program
that produced those results.  It won't be easy.

But you have some powerful advantages.  You have superior knowledge,
superior experience, superior technical skills, and the best computers
in the world."

Mishima paused and looked around the room.  A woman in front raised her
hand.

"Are we to assume that such a program actually exists?"

"Such a program did exist.  And the girl is the first and only human
being, as far as we know, to have had her germ line altered according
to this program's blueprint."

"Did exist?"

"Yes.  It was developed by Dr. Harold Goth, a Nobel laureate, whose
name, at least, you are probably familiar with."

Mishima heard some loud groans.

"Dr. Goth died in a fire in his laboratory on the island of El
Coronado, in the Caribbean, on New Year's Eve, 1999.  We believe that
all his records, including this genetic program, were destroyed in the
fire.  But we're not sure.  There is some recent evidence that a copy
may have survived.  An American and a German company may be
collaborating on an effort to fieldtest it."

"Can't we get a copy?"

"We're trying.  But if a copy has indeed survived, it may well be
flawed.  It may not work at all, for many reasons.  And as responsible
scientists, you would hardly want to rely on a pirated copy of
something as important as this.  The whole point of our undertaking
here is to reach a deep understanding of how this girl's genome was
created, so that we may construct our own working version of Goth's
program.  And like the copy of the Ford, we will make one that will be
better than the original."

An older male on the right side of the room raised a hand.

"What results has Goth's program produced in the girl?"

Mishima nodded.  "That's an essential question.  I cannot answer it
accurately now, but we'll do our best to supply you with information as
time and the success of our intelligence efforts permit.  All I can
give you at this point is a general answer.  The program has apparently
produced a child of markedly superior health and intelligence.  That's
all we know at the moment."

"Do we know this girl's name?  Or anything about her family?"

"For the time being, we consider that irrelevant."

Mishima answered a few more questions, then closed his presentation
with a strong dose of chauvinistic appeal:

"You all know, because each of you has been extensively interviewed
about joining this project, that our government places the highest
priority on the successful outcome of this endeavor.

Despite our success in building a peaceful, prosperous, and enlightened
society, Japan remains a small island nation in a brutally competitive
and increasingly hostile world.  The enormous economic boom of the
postwar period is well behind us now.  We have become a mature, rich,
and stable industrial democracy-one of the strongest on earth.  But our
preeminence is by no means assured.  In fact, it may be dangerously
fragile."

Mishima turned the projector switch on again, and the Ford sedan was
replaced by a new slide.  It was a chart listing eighteen categories of
productivity.

"I thought you might be interested in seeing how the three great
industrial nations of the world--Germany, the United States, and
Japan--presently stack up against each other in the key areas of
national productivity.  These figures may surprise you.  Germany t
leads in only one of the eighteen categories: finance, insurance, and
real estate.  Japan leads in four: chemicals, plastics, and synthetics;
cars, planes, and transportation; steel, aluminum, and opper; and
electric machinery and electronic equipment.  The United States leads
in all the rest--thirteen out of the eighteen i categories."

There was an awkward silence.  Mishima wasn't sure whether t, it was
because his audience was stunned by this revelation or because they
considered his patriotic appeal heavy-handed.  The last thing in the
world Mishima wanted was to be thought of as heavy-handed, but the
occasion demanded that he lay it on pretty thick.  The government
needed these scientific types to understand that this was a national
emergency.  They had to hit the deck running on this one.  One lost day
could make a difference.

Mishima turned off the projector, and the chart disappeared

; from the wall.  "For a while we were winners," he said.  "But no
longer.  We coasted on our success through the nineties.  Our economic
triumphs made us fat and complacent.  Now our economy and our standard
of living are on the decline.  Part of the reason

. for that decline can be blamed directly on the United States--on its
increasingly hostile attitude toward the Japanese people, and

- on the punitive actions that a series of U.S. administrations has

: taken--trade barriers, product quotas, tariffs, and all the rest.  I
need not bore you with the details.  Suffice it to say, we are now in a
bitter race for our survival as a first-class world power.  Since

' the Communist collapse back in the early nineties, we have witnessed
an increasingly belligerent United States doing all it can to sabotage
Japan's effort to compete in the world's markets.  The psychology of
the United States is such that it seems to require an enemy.  And now
that the Soviet Union is gone, that enemy has become Japan.

"To put it bluntly, we are once again at war with the United States.

It's a new kind of war-not the deadly military folly of the past but an
economic struggle.  The battlefield may seem far more benign and the
suffering far less, but the long-term consequences are the same.  The
loser ends up in the ash bin of history.

"But we are not going to lose.  We are a proud and industrious people,
capable of rising to a great challenge.  Fifty years ago, a previous
generation rose from the ruin and despair of a humiliating military
defeat to make us one of the richest, most productive societies on
earth.  We can repeat that miracle again.  And this time the task falls
to you, the men and women in this room, to lead the way.

It will demand commitment and sacrifice, intelligence and hard work.

But if you are successful, the reward will be priceless.  It is not an
exaggeration to say that the re-creation of this genetic program will
ensure the Japanese race a place of leadership in the world for many
generations to come."

Mishima sensed that his audience was getting restless.  It was time to
wrap it up.

"The prime minister and the emperor have both asked me to pass on to
you their warmest personal appreciation and their deep conviction that
once you know the importance of the task before you, you will not let
the Japanese people down.  I join them wholeheartedly in those
sentiments.  Now, I thank you very much for your time, and I understand
that there will be several more speakers who will answer the many
questions I know you must have, and lay out for you in more detail the
specifics of the project."

Mishima left the conference hall in a thoughtful mood.  He wondered
whether this effort was really an example of Japanese foresight and
long-term planning, or if it was the beginning of another great
folly.

If this genetics project was successful, what would the government
do?

Cash in on it by franchising it worldwide?  This is what the prime
minister had told him Japan intended to do.  But Mishima didn't believe
it.  Mishima thought it likely that his country would use the program
on itself--initiate a nationwide eugenics program to improve the
quality of the Japanese race.

This would be a dangerous course, Mishima thought--a thoughtless plunge
into a medical, social, and moral wilderness.

No one could predict where such a course might lead the Japanese
people, but of one thing he was sure.  The rest of the world would
never forgive them.

It would probably be better if the project failed.

Unfortunately, his reputation depended on its success.

Anne sat crosswise on a chair in the corner of Paul Elder's office, her
head resting against the wall and her legs draped over one of the
chair's arms.  She was reading a thick textbook called Modern
Genetics.

She had been at it for most of the past three hours and had reached
only page 15.  Still, she hardly minded.  She felt quite happy.

Indeed, she felt almost blissful, curled up in this cozy, cluttered
little office, alternating her attention between the book in her lap
and the man hunched over his desk a few feet from her.

Elder suddenly banged the desk with his fist and let out a howl of
frustration.  "Damn it!  I just can't make any sense out of it!"

He was stationed in front of a powerful desktop computer he had
borrowed through a friend from a nearby hospital research lab.  For the
last three hours he had been exploring the copy of Goth's Jupiter
program.  Anne could see that he was exhausted.

It was after eleven r.M and his day had started at five.  He swung his
chair around and rubbed his eyes.  Anne shut the book and looked at
him.

"Something's missing," he said.  "But I'll be damned if I can figure
out what it is.  Either I don't understand the genetics or I don't
understand the program--or both.  Probably both."

"Please don't try to do any more tonight."

"I'd like to accomplish something."

Elder had explained to her what he was doing each step of the way.  He
had started out with what he thought was the most traightforward
approach.  He had obtained from one of his labs 271 several disks with
copies of what the lab called "generic" genomes--ones that didn't come
from anyone in particular but were useful as test models.  He had fed
the data from a genome into the program's software as it instructed him
to do, and then asked it to alter the genome's DNA code according to
its master plan.

"This is the third time I've gotten the same result.  I feed the genome
data in, the program grinds away on it for a few minutes, then produces
a new genome--exactly like the one I just fed it.

Somehow I don't think that's what it's supposed to do."

Anne had been thinking about the problem herself.  She wanted to make a
suggestion but felt intimidated.

Elder was studying her.  "What?"  he asked.

She looked at him, confused.  "What?"

"You wanted to say something.  What?"

"Oh, I don't know.  Nothing."

He grinned.  "Yes you do.  Tell me."

"Well, I was just thinking.... Maybe you need to feed it two
genomes."

"Two genomes."

"Well, after all, it takes two genomes to make a baby--the mother's and
the father's.  Maybe the program needs the same ^'i number."

Elder rubbed his chin and gazed into the middle distance.  Anne felt
embarrassed; she wished she had kept her mouth shut.  Then his eyes lit
up.  "You're a genius," he said.  "And I'm an idiot.

You're right.  I'm sure you must be.  Let's try it."

Elder bent forward, grabbed the stack of disks he had borrowed from the
hospital, and sifted through them.  He found a male and a female
genome, popped the disks into the computer, and fed their data into the
program.  When it had accepted all the data, a question appeared on the
screen:

MALE OR FEMALE (M/F)?

"Look.  It's acting differently already.  It's asking us whether we
want a boy or a girl."  Anne came and stood behind the doctor, peering
at the screen over his shoulder.

"Let's have a boy," she said.  She felt an impulse to rest her hand on
the doctor's shoulder, but resisted it.

Elder punched the "M" on the keyboard.  A new message appeared:

SELECT PARAMETERS (or strike ENTER for preselected norms).

Elder struck the "Enter" key through a long list of coded parameters
that meant little to him.  When the list was exhausted, the program
followed with these questions:

STORE TO DISK?  (Y/N)

PRINT OUT?  (Y/N)

Elder punched "Y" for the first, "N" for the second.

TEST TRIAL OR APPLICATION?  (T/A)

Elder punched "T."

"Please Wait" flashed on the screen, and Jupiter began working on the
data.

"I'm worried about this taking up so much of your time," Anne said.

Elder shrugged.  "I don't need much sleep.  Even if I did, I couldn't
pass this up."

"I was thinking--maybe I could help you."

"You already have."

"No.  I mean with your work.  Help you around the office.  File things,
type things.  You need a secretary desperately.  Carmen's a great
nurse, but she spends half her time answering the phone and looking for
misplaced records.  I could do that.  And I could keep your
appointments book for you."

Elder seemed alarmed by the idea.  "But that's .  . . I couldn't let
you do that."

"Why not?  You can't deny you need the help."

"No, but .  . ."

"And I won't cost you anything."

"No, no.  I couldn't let you."

"Yes you could.  Look, Doctor, I need your help.  So let me do
something in return."

Elder kept shaking his head.  "No, no.  I'm sorry.  I appreciate your
offer, it's very generous, but .  . ."

"Will you at least think about it?"

Elder looked relieved.  "Okay."

Anne fell silent.  She went back to her chair.  It was a good idea, she
thought.  Why did he resist it?  It seemed to scare him.  She shouldn't
have put him on the spot like that.  He could have excellent reasons
that were none of her business.  She knew nothing about his life.  What
was the matter with her?  They had been getting along so well.  She
hoped she hadn't alienated him.

"Besides," Elder said, pretending to study a manual that was propped
open next to the computer, "what would you do with Genny?"

"She has a full-time nanny, paid for by her father, so she'd be
perfectly fine at home.  But if it was okay with you, I could bring her
with me--some of the time, anyway.  She'd love it.  You know she's very
well-behaved.  And she'd be so happy to be around some other
children."

Anne saw how conflicted he was, but she had the feeling that he wanted
her to persuade him.  She looked at him pleadingly.

"Will you try it?  For a week?  If you don't think it works after a
week, just say so.  I won't complain.  I promise."

"Okay."  Elder let out his breath in a long, ragged sigh.  He seemed
suddenly disgusted with himself.  "Hell, yes," he blurted out.  "I'd
like you to do it.  Having you here helping me would be great.  I don't
know why I have such a hard time admitting it.  I guess I just don't
expect anything from anybody."

"Sounds just like me," Anne said.

"Why?"

"That's my life story: don't expect or demand anything from anyone and
you'll never be disappointed.  I found out it didn't work.  I was
disappointed all the time."

Elder grinned.  It was the warmest smile she had yet seen from

.

. 1

,

:;

, j r

.;,

him.  "I thought you were probably pretty demanding," he said.

"And rich and spoiled?"

"That crossed my mind, too."

"Well, I'm not.  I married a man who was rich and spoiled."

"Ah."

"I grew up poor in Vermont."

Elder laughed.

"What's funny about that?"

"Where in Vermont?"

"Near Burlington."

"I grew up in Hartland.  Now that's really the sticks."

"You did?  My God!  I thought you were a native New Yorker.

What happened to your accent?"

"I lost it somewhere in medical school, I guess."

"What about family?"

"My folks still live in the house where I grew up.  Mom taught grade
school, Dad ran a garage.  Pretty ordinary people.  I go up and see
them three or four times a year.  I'm their only child.

They're pretty proud of me.  First doctor in the family."

An urgent beeping from the computer interrupted them.  Elder turned to
the keyboard and called up Jupiter's results.  He printed out the first
ten pages of data from each of the two genomes he had fed into the
machine, and ten pages from the new genome the program had created, and
placed the three sets of fan-fold paper side by side on the floor, to
compare their contents.  Anne knelt on the carpet beside him.

"Progress," he said, after a short look.  "God knows what the program
has created, but at least it's different from the two that we fed into
it."

Anne gazed at the long accordion folds of paper in complete
bafflement.

All she could see were endless rows of letters, spelling out nothing.

"How can you tell anything from that?"

"I can't.  Not yet, anyway.  But you can see that the code is different
in places."  The doctor pointed to a row of letters he had underlined
on the same line of the third page of each of the three sets:

ACCTCAGACTGTCTTCACGGTCTAGTCGATCGATCG

ACCTCAGACGGAACGCACGGTCTAGTCGATCGATCG

ACCTCAGACCTCCAACACGGTCTAGTCGATCGATCG Anne sat back on her heels.  "I
see the difference.  Is that all there is on all these pages?  Just
endless rows of A's, C's, T's, and G's?"

"Yup.  That's all."

"What can it possibly tell you?"

"Just about everything.  It's a complete set of instructions for
building a human being."

Anne expressed amazement.  "How many pages would there be if you
printed out the whole thing?"

Elder scratched his chin.  "I don't know.  Hundreds, I guess."

"Well, why only four letters?"

"The letters stand for four different nucleotides--adenine, guanine,
cytosine, and thymine.  They make up the billions of base pairs that
form the double strand of the DNA molecule."

Anne frowned.  "I should know that, shouldn't I?  I mean, I majored in
biology, after all.  But genetics wasn't emphasized that much.  Gregor
Mendel and his pea plants is about all I remember."

"Biology has come a long way since you were in college-which couldn't
have been very long ago."

Anne flushed.  It was the first time Elder had ever made any direct
comment about her.  Was he being complimentary or condescending?  "Is
it too late for me to catch up?"

"Of course not.  The basic concepts haven't changed.  But there's been
enormous progress--new discoveries, new terminologies, new
techniques.

I'm not very current in the field myself.  It'd be a full-time job just
keeping abreast of it all."

"Will you .  . . could you just review some of the basics for me?"  It
was unlike her to make demands like this on anyone.  The impulse
surprised her, but she didn't back away from it.

"You might find it tedious."

"No, no.  I sure I won't."

1

.

Elder scratched his chin again.  "Well, where to begin?  Maybe a quick,
simplified overview.  Every cell in the human body contains a command
center of sorts, a nucleus.  You probably remember that from--' "I
don't think blood cells have nuclei," Anne interrupted.

Elder nodded hastily.  "That's right.  Blood cells don't.  But most
others do.  Anyway, inside each nucleus there are chromosomes-little
wormlike clusters of specialized molecules made up of deoxyribonucleic
acid, or DNA.  We have forty-six of these chromosomes altogether.

Everybody's are the same, except males have an X and a Y chromosome,
females two X's.  These forty-six chromosomes carry all the human
genes.  And we still haven't found them all.  The latest count puts the
number at over 150,000.  And these genes are not separate
entities--they're really just special stretches of DNA code on the
chromosomes, each assigned to perform a specific function.  No, correct
that--each carrying its own set of directions for how to assemble and
operate a specific part of the human body.  Taken together, the genes
make up what we call the human genome.  They contain both the blueprint
and all the operating instructions for a human being."

Elder picked up the textbook Anne had been reading and found a page
showing a diagram of the DNA molecule.

"Each chromosome consists of two extremely long and extremely thin
parallel strands of DNA.  The strands don't lie straight.  Imagine a
long rope ladder twisted in a clockwise spiral over and over again
until it resembles a tightly knotted bundle of cord, and you'll have a
pretty fair picture of what a strand of DNA actually looks like.  The
rungs of that DNA ladder are formed by these four nucleotides.  They
bind together in what are called base pairs, two to a rung.  But they
don't bind in any old fashion.  Adenine binds only with thymine, and
guanine only with 1 cytosine."

Anne looked directly into Elder's eyes.  "Why is that?"

Elder lowered his own gaze.  "Hard to say.  Probably because of the way
the molecules are shaped.  In any case, that's the way it works.  So
those computer printouts on the floor are some of these long sequences
of base pairs.  They're coded instructions.  A sequence can instruct
the cell to manufacture a certain protein, say, needed in the blood, or
the brain, or wherever.  Let's change the analogy from a ladder to a
computer for a moment.  As you probably know, all computer language
code is built on a simple binary system--long strings of zeros and
ones--or yeses and nos, or negatives and positives.  When they're put
together in a certain order, they instruct a program to do
something--to add two numbers together, or to shift one paragraph of
type from one place in a manuscript to another place."

"But how can such complicated instructions be composed from just zeros
and ones?  Or from just combinations of only four letters?"

"What the language gains by being simple, it has to compensate for by
being extremely long.  A single simple computer instruction can require
a sequence of many thousands of ones and zeros.  The same applies to
our genome.  The number of base pairs it takes to initiate a simple
chemical reaction is considerable.  The number of pairs required to
create all our genes is in the neighborhood of three billion."

Warming to his subject, Paul Elder regaled Anne with the processes of
cell division, how DNA transfers its instructions via messenger RNA,
how cells specialize, how genes were first discovered, how cells
replicate themselves, and so on.  In his enthusiasm, he shed his
fatigue almost magically, becoming more alive and impassioned the
longer he talked.

Anne listened with rapt attention.  She knew she was being sinfully
dishonest, but she couldn't help it.  She already knew everything he
was telling her, and quite a bit more besides.  But she wanted him to
talk to her.  She was happy just to be close to him, to watch his
hands, his eyes, his expressions.  As far as she was concerned, he
could talk forever about anything at all.

She stuck in another question to keep him going: "Why is it that so
little of the genome--these three billion pairs--is actually used to
code for specific genes?  What's the purpose of all the rest of it--all
these millions of pairs that seem to have no function at all?"

A peculiar expression--something between an embarrassed

.

,

,.

.

. .

. i, r !, i' 1

I

I

. grin and a hurt look--transformed Elder's features.  "You know more
about this subject than I do, don't you?"

Anne laughed nervously and denied it.  She realized that she had given
herself away by asking him a question about something he hadn't even
described to her.  Their eyes met briefly, then veered abruptly away,
as if to avoid some kind of emotional collision.

Anne was experiencing the oddest sensations.  She didn't feel entirely
in control of herself.  Impulses she didn't even know she had seemed to
be taking oven-and she was blindly following them.  It was as if some
part of her that she didn't know existed had decided to assert
itself.

Elder glanced at his watch in shock.  "My God.  One o'clock in the
morning!  I've been yakking away like a damned maniac.  Why didn't you
tell me to stop?  You must be ready to drop."

"I loved it.  Really, I did."

Elder stood up, took a deep breath, and shoved his hands in his
pockets.  "Well, anyway," he said, sounding suddenly quite -i uncertain
of himself, "those are some of the basics."

He groped for something else to say.  Anne gazed at him with anxious
expectancy.

"Well, I'm sorry I went on so long, anyway," he mumbled.

"You're too polite."

Anne felt giddy.  A sensation of weightlessness took hold of her, as if
she were in an elevator that had suddenly begun a rapid descent.  Her
heart was pounding, her skin prickled, her face burned, and she
couldn't catch her breath.  "Do you like me at all?"  she blurted
out.

Elder tried to act as if he hadn't heard the question.  A tide of red
advanced up from his neck and swept over his cheeks.  He opened his
mouth, but nothing came out.

"What I mean," Anne continued, in a quavering voice, "is, well, I like
you but maybe you don't like me, and that's okay, I certainly
understand."

"But of course I do like you," he replied.

"Well, 'like' isn't really what I meant," she stammered.  "I mean, what
I really mean is--" Anne bit her lip.  She jumped up from the chair,
clutching her handbag and shaking her head.  "I really must go.  My
God, I'm sorry.

I'm not throwing myself at you.  Really I'm not.  But you're so ... I
never did this...."

She bolted out into his darkened outer office and fumbled with the lock
on the door that led out into the building's corridor.

Elder followed her, but she got the door open and dashed out into the
corridor with the panicked fright of someone fleeing for her life.

"Anne.  Wait."

He ran after her out of the building lobby and onto the sidewalk.

"Wait.  Let me get you a cab, for godsakes!"

She shook her head and set off down the block at a fast trot.

She glanced back.  He was still following her.

"Anne!  It's late.  You can't go home by yourself at this hour!

Anne!"

Elder followed her for a block, where she hailed a taxi on her own and
scrambled in.  As the cab pulled away from the curb, she caught one
last glimpse of him, standing on the sidewalk.

Back at her apartment, she slammed the door and leaned against it.  Her
heart was pumping furiously.

Mrs. Callahan appeared from the back bedroom and snapped on the
light.

"Are you all right, Mrs.  Stewart?"

Anne nodded energetically.  "Yes--fine!"  she gasped.  "Sorry if I woke
you."

"I heard the door slam," the woman said, eyeing Anne suspiciously.  "I
was worried.  It was so late and you not home yet.  Are you sure you're
all right?"

"I'm perfectly okay.  Please go back to bed."

"Have you been running?  You're all out of breath.  Did someone chase
you?"

"No.  I was just getting a little exercise.  Please."

Anne finally persuaded Mrs.  Callahan that she was all right.

The woman returned to bed, muttering to herself.

Anne suffered through a long, sleepless night.  At nine o'clock in the
morning a package arrived by messenger.  It was her RCD copy of the
Jupiter program.  In the haste of her emotional departure, she had
completely forgotten about it.

There was also a note:

Sorry you ran out.  Serves me right for being such a bore.

Hope you'll forgive me.

Best, Paul Elder

5 Anne read the note over and over.  She considered calling Lexy and
asking her advice, then decided she had suffered enough humiliation for
one twenty-four-hour period.

: It meant what it said, she decided.  No more, no less.  He was
obliged to return the RCD, so he had thoughtfully included a polite
note with it, trying to make her feel a little less embarrassed.

i And that's all the note was--polite.  No feeling in it at all.

Surely the man wasn't so inhibited that he couldn't have responded with
a little more affection and warmth if he had wanted to.  "Best"
indeed.

He might as well have said "Sincerely yours."

Anne tore the note up and threw it away.  She decided that if he called
and said he wanted to see her again, she'd see him again.

If he didn't, she wouldn't.

She waited for the call for many days.  Every time the telephone rang,
her heart lurched.

r. But the call never came.

Dr. Laura Garhardt sat stiffly at attention as Baroness von Hauser
thumbed through a thick, leather-bound folder, crammed with several
hundred pages of neatly printed test results, including Xrays,
sonograms, genome profiles, and medical interviews.  The book
represented the first comprehensive report on the twenty Romanian women
who had volunteered for the pilot genetics program.  The report covered
the first five months of their pregnancies.

Garhardt and the other doctors on the project had spent a considerable
amount of time on the report.  They knew from past experience how
unforgiving the baroness was of sloppy work or faulty
interpretations.

At the front of the book was a two-page letter, written by Garhardt and
signed by all the researchers and doctors in the project, that
summarized the contents of the report.  The baroness read the letter
carefully several times.  The rest of the report--the pages and pages
of details--didn't much interest her.

She closed the book and dropped it on her desk.  "So," she said,
tilting back in her chair and smiling at Garhardt.  "Everything is
going well."

Garhardt nodded politely.  "Yes, Baroness.  Exceedingly well."

The baroness studied Garhardt for a few moments, one hand playing idly
with a gold pen, first rolling it between her fingers and then tapping
it gently against her cheek.  "Are all the women following your
orders?"

285

Dr. Garhardt cleared her throat.  "Yes.  With a few minor
exceptions.

We've had to remind some of them not to neglect their temperature
charts and daily maternity diaries.  And several of them have been
casual about obeying diet restrictions.  I think we have those matters
under control, however."

"Yes.  You said as much in your covering note.  I'm pleased to hear
it."

Garhardt said nothing more.  She gripped the arms of her chair to keep
her hands from betraying her nervousness.

The baroness caressed the pen in her palm.  "Do you have any
observations--perhaps personal or subjective--that you would like to
add that are not in the report itself?"

Dr. Garhardt wrinkled her brow.  "No.  No, I'm sure everything
important is there."

"Any complaints?"

Garhardt caught her breath.  If she had had any choice in the matter,
she never would have agreed to work for the baroness.

But she didn't have a choice.  Garhardt's father had been a prominent
administrator in the former GDR's criminal-justice system during the
days of Erich Honecker's Communist regime.  Somehow the baroness had
obtained a cache of secret official documents that revealed how her
father had been responsible for implementing a Stasi program that
coerced judges into sentencing innocent dissidents to long jail terms
and placed hundreds of others in mental hospitals.  Her father was
still alive, living out a peaceful retirement with her mother in a
small village in Saxony.

If the documents were ever made public, her parents would be
destroyed.

The baroness had never overtly threatened to make use of the
documents.

She didn't have to.  It was enough that Laura Garhardt knew that she
possessed them.  That left it up to Garhardt never to provide the
baroness with any temptation to use them.

"No complaints at all, Baroness."

"Is there anything more you want or need?  Anything more in terms of
supplies or personnel?  Is there anything at all the project needs that
we have neglected to provide?"

"Not that I know of, Baroness.  We are well taken care of, thanks to
the interest and attention you've given the program."

This was not quite true.  When the project was first getting under way,
Garhardt had insisted that the genetic software, the so called Jupiter
program, should be subjected to rigorous dry runs and other tests
before it was tried on any human subjects.  The other doctors and
researchers were coming around to her point of view when the baroness
intervened.  Jupiter had already been tested on at least one other
woman, she told them, and the results had been excellent.  It would be
a waste of time if they fiddled around examining something that had
already proven itself.  They must move ahead with the pilot program as
quickly as possible.

1 Reluctantly, Laura Garhardt obeyed.

i, "I'd like another report in two months," the baroness said.  "Of
course, if anything unusual comes up, I expect to be informed at
once."

"Of course."

"And Doctor, next time don't bind your report in leather.  This is not
a work of Goethe or Schiller."

"Of course not.  I'm sorry, Baroness."

Baroness von Hauser swiveled her chair to one side and focused her
attention on the forest of blinking lights on her telephone console.

She waved a hand absently toward the door without looking up.  "That's
all, then."

Dr. Garhardt muttered a barely audible "Bitte" and made her exit.  In
the three years that she had worked for Hauser Industries, she had
probably seen the baroness less than a dozen times.  And she never had
been in her presence for much more than a few minutes.  But each time,
her fear of the woman took on additional

1 strength.  If it had not been for that fear, she would have taken the
opportunity the baroness had given her to add a personal observation to
the report.  But she had not dared.  To bring up anything negative, she
had learned, was to risk the baroness's displeasure.  Better to keep
one's mouth shut and stay out of trouble.  Better to wait until the
next full report was due.  With any luck, the next two months would
give Garhardt time to decide whether her observation should be made or
not.

It was such a very small thing, really--a slight anomaly in one

of the blood tests.  The hemoglobin profiles were consistently
irregular in all twenty-four fetuses.  Strange.  No visible
deformities, though, and nothing abnormal on any of the other tests.

The doctor intended to make a thorough, detailed study of the profiles
of the beta and epsilon globin genes from some sample normal
pregnancies.  But first she would have to locate a quantity of them.

Perhaps in two months the hemoglobin would return to normal.  Doctor
Garhardt certainly hoped so.  She was damned if she wanted to be the
one to bring any bad news about Jupiter to the baroness.

q

'

.

,

;,

.

"Rabbit needs a friend," Genny said.  She was tugging her mother in the
direction of the stuffed-animal display at the F.A.O.

Schwarz toy store on Fifth Avenue.

"I thought Rabbit had quite a few friends.  There must be forty stuffed
animals back in your bedroom."

Genny shook her head.  "I only have thirty-five, Mommy."

Anne laughed.  "I forgot you knew how to count that high."

"And he needs a special friend."

"Do you have anyone particular in mind?"

Genny pointed toward an enormous stuffed brown bear.  The price tag
dangling from one of its paws read $850.

"No," Anne said, very firmly.  "He's much too big.  There's no room in
the apartment for him."

"Please, please, Mommy?"

"And he's much too expensive, as well."

Genny pouted.  "I'm going to tell Daddy to buy him, then."

Anne sighed.  Her daughter had begun playing Dalton off against her
recently.  Along with her other precocious habits, she was also
beginning to demonstrate a talent for manipulation.

Since the apparent end of her relationship with Dr. Elder, Anne had
been spending all her time with her daughter.  She had also invested a
lot of money in a high-end computer system so that she could continue
working on Jupiter on her own.  But she hadn't yet mastered the
operation of the computer itself.  She was still reading the manuals
and trying to make sense of it all.  She needed 289 help for both the
computer and the Jupiter program, but she didn't know where to turn.

She wished she could ask Hank Ajemian for advice, but of course that
would mean revealing that she had stolen the copy of Jupiter from
Dalton's safe.

She began to wish that she had never taken the damned program in the
first place.  Its very presence in her apartment had become a constant
source of worry.  It was as if she had stolen a famous piece of jewelry
or art.  She couldn't menu-n Illnitr t anyone without risk.

She had called Ajemian anyway, to ask him about the pilot program in
Romania.  When the babies in the first trial program were born, some
useful information might develop that would apply to Genny.  And if
there were any problems, the geneticists in Romania were far more
likely to find them than Anne.

So far, Ajemian had informed her, the mothers were all doing fine.

Genny was tugging at her sleeve.

"Pick out something else," Anne said.  "How about that white bunny over
there?  She's just about Rabbit's size, too.  I bet he'd like her."

"How do you know it's a girl, Mommy?"

"Well, I'm not sure.  But she looks like one, don't you think?"

Genny shook her head.  "I already have three bunnies--Rabbit, White
Tail, and Fuzzy.  I want that big bear."

"I know what," Anne said brightly.  "Why don't we go look at dolls ?

" Genny stamped her feet.  "I hate dolls."

"You do?  How come?"

Genny put her hands on her hips and thought about it.  "They aren't
real.  That's why.  They're just pretend."

"You love that big doll that Lexy gave you, don't you?"

"She's not actually a doll, Mommy," Genny corrected.  "She's a Raggedy
Ann."

Anne looked around the store to see where the dolls were located.  Near
the front entrance she caught sight of a man standing over by the model
trains.  He was about thirty-five, dressed in a

. .

nondescript gray suit and dark tie.  She had seen him before.  He was
following them.  She was sure of it.

Anne watched him.  He wasn't paying much attention to the trains.  He
fingered a few of them absently, then glanced in her direction.  Their
eyes met for an instant.  He gave nothing away.

He looked past her, as if something on one of the shelves over her head
had caught his interest.  Then he turned away.

Anne grabbed Genny's hand and pulled her toward the back of the
store.

She'd wait him out, she decided.  Just stay in the store--until it
closed, if necessary.  Genny wouldn't mind.  She could easily spend the
entire day there without complaint.  If the man was following them, he
would be obliged to stay as well.  If he wasn't, he would presumably
leave.  Anne glanced at her watch.  Three o'clock.  The store closed at
six.

Genny was still sulking about the big stuffed bear.  She wouldn't let
her mother hold her hand.  She walked, stiff-legged and grimfaced, from
aisle to aisle, refusing to take any interest in anything.

"You're the worst mommy in the whole world," she muttered.

Anne kept her eye on the man.  At one point he seemed to be leaving.

He walked to the entrance, paused, looked out, and then turned around
and came back in Anne's direction.

Damn him, Anne thought.  How long was she going to have to put up with
this?  She walked toward the front counter.  Perhaps she should report
him to the management.  But what could she report, really?  That she
thought he was following her?  He hadn't actually done anything.  He
hadn't spoken to her.  He hadn't touched her.  They'd think she was
loony.

Anne turned away from the front counter and studied the display on some
shelves to the left, trying to decide what to do.

Maybe it was best just to leave in a hurry--grab Genny, jump in a taxi,
and lose him.  She walked back down the aisle where she had left her
daughter, moping disconsolately by the Lego sets.

Genny wasn't there.

Anne peeked around the corner and down the next aisle.  No Genny.  She
called out her name in a low voice.  No answer.

She glanced down the other two aisles.  "Genny, where are you?"

Anne searched hurriedly through the store.  Genny wasn't tall enough to
be visible over the display shelves, but the man was.

She didn't see him anywhere, either.

"Genny!"

Anne ran toward the back of the store, tripping over the foot of a
young boy on the way.

She stopped.  "Genny!"

No answer.

She dashed to the front of the store.  Her mind felt scrambled.

"Oh no oh no oh no" rang in her head like an alarm bell.  She ran out
the front entrance and looked up and down the street.

No Genny.

Anne rushed back inside and collared a startled middle-aged
saleslady.

"My daughter!"  she screamed.  "She's gone!  She's been kidnapped!"

The woman called security.  The couple of dozen customers in the store
froze in place and looked around them fearfully.

"My daughter!"  Anne yelled at them.  "She's gone!"

The noise level in the store increased dramatically.  Customers and
clerks rushed to the front and crowded around the entrance, expecting
to catch a glimpse of something--a fleeing car, a police chase.

A security man appeared and asked Anne what had happened.

"He took my daughter!"

"Who did, miss?  Did you see anyone?"

"Yes!  " "Try to calm yourself, miss."

Anne couldn't catch her breath to speak.  She gasped as if hit in the
stomach.  She began running aimlessly up and down the aisles, casting
her eyes around desperately.  "She was right here!

A minute ago!  That man took her!"

The security man trotted along behind her, trying to keep pace.

"What man?"

Anne halted abruptly in front of the stuffed-animal display.

Curled up in the lap of the big stuffed bear, with its paws pulled
around her shoulders, was her daughter.

Genny looked up into her mother's still panic-stricken face with a sly,
slightly guilty smile.  "I was hiding on you," she said.

Paul Elder finished writing in the last patient folder in the pile and
pushed the stack to one side.  He yawned, rubbed his eyes, and glanced
at the clock.  Past midnight.  He must get to bed.  He had early rounds
to make at the hospital.

Elder lived nine blocks from his office.  He used to enjoy the walk.

It gave him a few minutes to relax and get his mind off his work.  But
during the last few weeks that walk had become a subtle torture.  He
could think of only one subject: Anne Stewart.

It was extraordinary.  He barely knew her, yet he had never missed
anyone as intensely as he had missed her ever since the night she had
walked out of his office.  For the first time in his entirely
self-sufficient existence he felt lonely.

He had thought of dozens of plausible reasons to call her.  She really
did need his help.  He had thought of all kinds of advice and
suggestions to give her about her daughter.  Several times he had
actually had the phone in his hand and begun to dial her number.

But so far he had come to his senses in time.

Anne Stewart was not for him.  Despite her humble origins, she now
enjoyed a luxurious and comfortable existence in a world alien to
him.

How quickly she would find him and his life boring!

Getting involved with her would be crazy and destructive.

And yet .  . .

God, how he ached to see her again!

Images of her swam into his mind unbidden.  She was the most beautiful
creature he had ever set eyes upon.  Everything about hen-the way she
moved and talked and looked at him--held him transfixed.  And when they
were together their chemistry had seemed so strong.

Yet she had just gone away.  Because he had discouraged her.

Why hadn't he been warmer, more approachable?  Why had he been so
damned afraid to follow his own instincts?

No.  She'd only break his heart sooner or later.  Hell, it felt as if
she'd broken it already.

He passed a pay phone.  He knew the number by heart.

Maybe he should call her, just to talk to her.  But it was too late
tonight.

Tomorrow, then.  He'd call her tomorrow for sure.

No, no.  That was dumb.  He had to just forget about her.

Elder realized that he had arrived at his destination.  He walked
through the lobby of his apartment building, said goodnight to the
doorman, and rang for the elevator.  He felt tired, suddenly.

He always felt tired, at the end of the day.  He worked too hard, he
knew.  He had to make some changes.  Have a little fun.  Enjoy life.

Not spend so much time alone.

How long would it take?  he wondered.  To forget about her?

"I've spoken to a number of people," the baroness said.  She removed
her exercise shorts and leotard and stood naked on the bedroom's thick
fur rug, glistening with perspiration from her late-night workout.

"Very discreetly, of course.  The interest is there.  We should begin
serious planning now."

"A little premature, isn't it?"  Dalton Stewart was sitting, fully
clothed, on the baroness's king-size bed.  He had been napping in a
guest room, down the hall, trying to recover from the wine and brandy
he had consumed at dinner earlier in the evening, when the baroness had
awakened him and invited him into her room.

"The babies from the pilot program aren't due for another three
months."

The baroness toweled herself off slowly.  She was completely
unselfconscious in his presence.  "And they're all developing
perfectly, Dalton.  Three months will pass quickly.  We should start
selecting our first clients now."

"That worries me."

"Everything seems to worry you these days, Dalton.  Are you feeling
ill?"

"At the moment, yes.  From the wine."

"You need more exercise."

Stewart studied the baroness's body as she rubbed the towel
energetically across its firm surfaces.  Certainly she wasn't one to
neglect exercise.  She was not precisely his erotic ideal--Stewart
preferred his females a bit more lusciously rounded, with fuller
breasts.  Like Anne.

The baroness arched her legs slightly apart and rubbed the towel
briskly against her pubic hair.  "We shouldn't wait.  We should assume
the babies in the test program will be born and develop just as your
daughter has developed.  We must assume that--otherwise what do we
do?

Wait for several years to make sure the children are superior?  No.  We
can't wait that long.  We have to accept the possibility that someone
else may have a copy of Jupiter."

"It's unlikely."

"I don't agree.  Goth's assistant sold you a copy, didn't she?

Why couldn't she have sold one to someone else?"

Stewart didn't bother to argue the point.  She could be right, after
all.

"And we must be more careful with our own copies," the baroness
continued.  "At this moment there are four: one in my Munich office,
one in your New York office, and two at the Romanian clinic.  They must
all be copy-proof."

"I thought they were."

"Not sufficiently, according to my lab in Munich.  They can add a
ten-digit access code to the program.  If anyone attempts to copy or
print from it, or even call it up on the screen, without entering the
correct number sequence, it automatically shuts down.  The copies in
Sibiu and Munich are already encoded that way.  That leaves the copy in
New York.  We must fix it immediately."

"It's locked in a safe in the wall of my office.  No one else has
access except Ajemian.  It's perfectly secure."

"We must code it.  That's not an unreasonable request, Dalton.

There's no way to copyright Jupiter, after all.  It's illegal in most
countries.  So our only protection is to make sure it doesn't get out
of our hands.  Karla is in New York now.  She could take it to the
Munich lab.  Would you please instruct Ajemian to give it to her?"

"If you insist."

The baroness wrapped the towel over her breasts and tucked it in under
her arms so that it hung from her like a strapless gown.

"In the meantime, we must get to work in Romania.  We only have a few
months to renovate that place."

She headed for the bathroom.  She paused at the door and smiled at
him.

"Don't go away," she said.  "I have something important to discuss."

She closed the door behind her, and in a few minutes Stewart heard the
shower running.

Watching her with the towel had aroused him.  Despite his
alcohol-induced headache and general lassitude, he thought he could
probably perform adequately enough--if she was interested.

If she was interested.

The uncertainty was a novel experience for a man who had indulged
himself much of his adult life energetically pursuing and seducing
women.

The baroness, he had discovered, was quite different from the women he
had known.  For one thing, she had an uncanny ability for stealing the
initiative--of somehow always being in a position to dictate the terms
of their relationship.

He understood now why she was so successful in her business dealings.

She was always the most determined, the most organized.  She was
untiring and perfectly focused.  And she always knew exactly what she
wanted.  This, combined with her willpower and lack of scruples,
enabled her to get her way in almost any situation.

She seemed to have no exploitable weaknesses, either.  She didn't take
drugs, she didn't drink much.  She had no family that she cared about,
no children, no close friends.  And she lived in a fortress
environment, protected by alarm systems, bodyguards, and attack dogs.

Gradually--bit by bit, day by day--Stewart found himself sliding into a
subordinate relationship with the woman.  He was aware that it was
happening, yet he felt powerless to do anything about it.  And ending
their partnership now was out of the question.

He had hoped, in the beginning, to forge some kind of acceptable
association with hen-if not a completely loving and intimate one, at
least an alliance of mutual interest.  But that now seemed
impossible.

She was simply too demanding and difficult a woman, unable to accept
any show of affection on his part as anything other than an invitation
to tease and manipulate him.

For weeks she would massage his ego, praising him in the presence of
others, deferring to him, acting supportive.  Then, when he was
beginning to feel some comfort in her presence, she would start subtly
undermining him by criticizing him or even embarrassing him in
public.

Nothing about her could ever be taken for granted.  She kept him
constantly off guard.  It was quite maddening.

As for sex, it was to her an itch to be scratched, no more.  And the
more satisfaction one could get out of the way one scratched, the
better--as long as it didn't interfere with one's real life.  If he
wanted good sex, she explained, then he should learn to experience it
her way.  He soon found out exactly what she meant.

One night fairly early in their relationship he was awakened from a
deep slumber to feel the bed shaking violently under him.

The room was in semidarkness.  A small lamp was lit on the baroness's
dressing table.

He raised his head, alarmed.  There was violent movement, other bodies,
sharp cries .  . . some kind of struggle going on.  His first confused
thoughts were that the baroness was being attacked by somebody.  He
twisted around and sat up, ready to fight or flee for his life.

In a few seconds his first impressions dissolved.  Fright gave way to
astonishment.

Two other people were on the bed--Aldous and Katrina.  And both were
piled on top of the baroness.  Katrina was lying prone with her legs
spread wide and her face buried in the baroness's blond hair.  Aldous,
in turn, was on top of Katrina, grunting like an animal and ramming his
penis violently into her from behind.

One of Katrina's elbows kept hitting Stewart in the side.

It was too late to feign sleep.  He sat there, immobile, trying to
decide how to react.  Expressions of outrage would probably be laughed
at.  And retreating from the bed would be cowardly.

The scene changed.  The women were now wrapped in a passionate kiss,
and Aldous was now pumping away furiously inside the baroness.  She was
moaning and shuddering with pleasure.

Seeing Stewart awake, Katrina reached a hand across and grabbed his
penis.  She fished it impatiently through his pajama fly, then squeezed
it hard and giggled.  She seemed drunk, or high on drugs.  In spite of
himself, Stewart felt powerfully aroused.  He had had sex with many
women, but never in a crowd.

Katrina climbed on top of him.  Protestation was pointless.  Katrina
swiftly straddled his hips and impaled herself on him with a long,
shuddering moan.

The baroness reached over and began stroking Katrina's belly.

She slipped her hand further down and closed her fingers around the
base of Stewart's penis.  Katrina increased her movement, pistoning up
and down violently.  He exploded inside her almost immediately.

Katrina paused, then gently began her pumping motion again.

The baroness kept her fingers around him.  His penis stayed hard, and
within minutes Katrina had him on the verge of coming again.  And then
her own orgasms began--one after another, at rapid intervals.  She
shuddered, whimpered, moaned, tossed her head back and forth.  Her eyes
and jaw shut tight.  He could feel her vagina muscles squeezing him
powerfully.

The baroness, far more excited now than Stewart had ever seen her,
began her own paroxysms.  She locked her legs around Aldous, clamped
jaw and eyes shut, and launched herself into an extraordinary series of
angry convulsions that seemed to last for minutes.

Stewart came again, even more powerfully than the first time.

The orgasm seemed to start somewhere in his toes, shoot to the base of
his spineand explode through his penis in a scalding eruption that was
as painful as it was ecstatic.

Katrina, still in a state of sexual frenzy, rolled off Stewart and
returned her attention to the baroness, licking and sucking at her
breasts hungrily.

The other three continued their revelry, moaning and squealing and
giggling and gasping in various configurations.  Stewart, stunned,
spent, and vaguely angry, lost interest in the proceedings and
retreated to a bed in a room down the hall.

More nights like that first one soon followed.

Sometimes only Katrina was present, sometimes only Aldous--whatever
suited the baroness's whim.  Sometimes they were in costume; sometimes
they were in restraints.  The baroness loved to wield a whip on both of
them.

Conventional sex held little interest for the baroness.  Some of what
did interest her repelled Stewart--especially her penchant for
sadomasochism--but gradually the shock was wearing off, as the baroness
repeatedly challenged him to broaden his sexual horizons.  Sex became a
kind of no-holds-barred competition, a game of sexual chicken.  The
baroness's kinky tastes kept her constantly out in front of him.  She
initiated; he reacted, permanently on the defensive.

His sudden immersion in this bacchanalian maelstrom disoriented
Stewart.  He found himself spending far too much time recovering from
some of the sessions, and far too much time thinking about them
afterwards.  The baroness, by contrast, compartmentalized her life
rigorously.  Sex was simply not central to the passions that powered
her existence.

Stewart suspected that she was laying on all this sex for him at least
in part just to probe him for his own weaknesses--to get him ever more
deeply hooked and dependent.

By slow degrees the woman was shattering Stewart's complacent
assumptions about himself, luring him ever deeper into a pattern of
self-destructive behavior.

Katrina had further muddied the situation by developing an attachment
to him.  She was immature and clinging, and prone to getting herself
into trouble.  She was also a heavy drug user, and despite the
baroness's threats she was unable to give them up.  She had been
arrested several times; twice Stewart himself had pulled her out of
trouble.

Stewart persuaded himself that he was just biding his time.  He would
tolerate whatever he had to, and eventually things would go his way.

Once the Jupiter program was established, the money would start coming
in, and he could free himself of his indebtedness to the baroness.  He
could rebuild and expand his companies and see his empire grow again.

And he still clung to the hope that he would eventually persuade Anne
to come back to him.

The baroness came out of the shower with a fresh towel wrapped around
her.  "I was thinking that it might be a good idea if we got married,"
she said.

Dalton stared at her, dumbstruck.

She smiled teasingly.  "Are you against the idea?"

"I don't know.  But I certainly assumed you were."

The baroness sat on the edge of the bed and began drying between her
toes with the towel.  "I've changed my mind."

"Why?"

"Neither of us is suitable for a conventional marriage, of course.

You've been divorced twice, and are about to be divorced again.  I've
never remarried because I knew beforehand that it wouldn't work.  But
the kind of arrangement that the two of us now have could just as
easily be continued in the legal framework of a marriage.  And under
those circumstances, there would never really be any reason to get
divorced."

"Why get married in the first place, then?"

"There are business advantages.  For both of us.  And that's really how
I would view a marriage--strictly as a business contract."

"Anne and I are still a long way from divorced.  And there's Genny's
welfare to think about."

"Of course.  She's the main reason that we should do this," the
baroness said.  "I can help you get custody."

Stewart brought his eyes up from the baroness's vigorous toweling of
her thighs.  "How can you do that?"

"Obviously, if you're going to marry again, the court'll look more
favorably on you for being able to provide a wholesome family
environment for your daughter."

Stewart wondered if the baroness was making a joke.

"And that, combined with an extremely generous financial settlement,
should do it.  Your wife has no money of her own, after all.  She
should be grateful for a reasonable arrangement--frequent visiting
privileges, that kind of thing."

"The child is much more important to Anne than money."

"Nothing is more important to anyone than money, if there's enough of
it.  Your wife grew up poor.  She doesn't want to be poor again.  And
she doesn't want her daughter to be, either.  She can be persuaded."

"Why do you want me to have custody?  You don't like children.  And you
and Genny certainly didn't hit it off."

"We must have her, that's why.  Think it through.  So far she's the
only proof that the Jupiter program works.  Her presence will be
wonderfully persuasive.  Nobody will be able to resist Jupiter after
seeing her.  Without her, we run the risk of losing our investment."

Her words hit Stewart like a slap.  He felt furious.  "You're talking
about my daughter as if she was a sales gimmick."

The baroness sat up.  "But you must see my point.  And you do want
custody of the child, don't you?"

"Anne's a very good mother."

"I'm sure she is.  And what about you?  Do you want to be a good
father?  Genny cannot live with both of you."

The baroness got up from the bed and disappeared into her dressing
room.  She reappeared a few minutes later, wearing black silk
lingerie.

She had combed her blond hair out and anointed herself with a
particularly potent perfume.  "You can stay, if you like."

No.  He needed time to think.  "I'm driving back to Munich," he said.

A light rain was falling, and Dalton Stewart drove slowly.  All the way
down the narrow, twisting turns of Route 16 south from Regensburg
through Saal and Abensberg, and on the broad engineered stretches of
the E-6 Autobahn from Geisenfeld to Munich, he reflected upon what the
baroness had said.

He did want custody of Genny.  And Anne would put up a ferocious battle
to keep her.  So marrying the baroness would probably help him get
custody.  But then what?

He remembered the rumors about the baroness--the suspect circumstances
surrounding the deaths of both her father and her husband.

He stared through the windshield at the deep orange glow cast against
the clouded night sky by the lights of Munich, still twenty miles
distant.

The baroness didn't want him.  It made no sense.  She wanted Genny.

And marrying him was the only way she could get her.

And once she became Genny's stepmother, she'd have no need of Dalton
Stewart.

Christ, he thought.  He had made a business deal with the Devil.

Anne pushed her chair back from the desk.  She had made some error, she
decided.

She repeated the experiment.  She inserted the RCD with her own genome
on it into the computer and carefully followed the directions for
transferring the data into the database of Goth's program, reading the
instructions out loud to herself as she proceeded.  Then she repeated
the process with Dalton Stewart's genome.

When these steps were complete, she instructed Jupiter to do what Goth
had presumably designed it to do--analyze the two genomes and produce
the blueprint for a third one that would marry these two, correct any
genetic flaws, and add its own mysterious genetic enhancements.

Once the program had done this--and it took a while, because even at
the lightning speed with which this computer could crunch data, it had
to compare and select among billions of base pair combinations before
constructing its new genome--Anne then fed Genny's genome into the
database and asked it to compare its freshly created blueprint with
Genny's.

Anne had expected the results to show a one-hundred-percent match.  The
arrangement of all the billions of base pairs along the chromosomes of
the two genomes should be identical in sequence.

But they weren't.  For the second time, they showed a roughly
ninety-nine-percent match.  And that, in genetics, was not accuracy; it
was not even a close miss.  It meant that the sequences

304

I differed in several million locations.  It could just as well be the
genome of a chimp or a pig.

She considered the possibilities.

Could some of the genome data itself be flawed?  Unlikely.  She was
sure that both her and Genny's genomes were correct, because she had
obtained three genetic samples for each of them, gotten three separate
genome readouts from three separate laboratories, and run numerous
computer cross-checks on them.  She had gotten perfect matches every
time.

Dalton's genome had been taken from hair samples collected by Anne from
one of Dalton's hairbrushes.  Anne had also had multiple tests run on
these, and again they had come out identical.

Was the Jupiter program itself flawed?

It was at least internally consistent.  It made no mistakes with the
material that Anne could cross-check.  She had suspected at first that
it might be designed to create automatically a different genome from
the same two sets each time they were fed into it.

That was what nature itself did, after all.  Except for identical
twins, every new union of sperm and egg from the same man and woman
produced a different child, with a slightly different genome.

But the program appeared to be designed to accommodate this.

It offered specific instructions that allowed the operator to determine
in advance which of a whole range of variables she wished to manipulate
and provided her a specific scale of choices to follow.  It also
allowed the operator to scan any genome fed into it and get back a
detailed readout of all these variables.

Anne had done all that.  She had loaded into the program the identical
choice of variables it had informed her were in Genny's genome, and she
had rechecked herself every step of the way.  But it didn't matter.

Jupiter simply refused to reproduce Genny's genome.

What possibilities were left?

That the hair taken from the brush didn't belong to Dalton Stewart?  Or
that Dalton wasn't Genny's father?  Goth could conceivably have
substituted someone else's sperm.  For all she knew, he could have used
his own.

No, no, no.  That was all wrong.  Genny's genome had been screened
genetically when she was only a few weeks old, and the laboratory
results had shown unequivocally that Dalton Stewart was her father.

So it came back to Jupiter.  The program was flawed.  Yet how could
that be?

There was her daughter, Genny--a most extraordinarily gifted child.

But not just gifted: Genny possessed capacities not known to be in the
human gene pool.  She appeared to be a unique specimen of Homo sapiens,
something never seen before.  Where else could these characteristics
have come from except from Jupiter?

If the program itself was not at fault, what was left?

Anne could think of only one further possibility: she wasn't using the
program properly.  Yet if that were so, why did it seem to work at
all?

Why didn't it just flash a big "ERROR" message at her?  Or turn itself
off?  Anne wished she knew more about computer software.

Anne rebooted the computer, called up the Jupiter program, and looked
at the sign-on screen.  There was nothing to indicate authorship or
anything else.  Just the enigmatic direction "LOG ON)."

She hit the Enter key and looked at the next screen.  It contained a
menu of options.  The relevant choice here was item 6: "ENHANCED GENOME
CONFIGURATION.  She pressed 6 and got a second menu.  The relevant item
here was number 4: "GENOME PARAMETERS.  She pressed 4 and got the long
list of genetic variables to choose from.  The next direction was
"ENTER DATA,

FIRST GENOME.

Goth was no doubt a genius, Anne thought, but how had he had time to
learn computer programming on top of all the work he was doing in
genetics?  Programming, especially at this level, was unquestionably a
demanding, time-consuming discipline.

She turned the computer off and thought about it.  Someone-some
programmer somewhere--must have written it for him.  She decided to try
and find out.

The next morning Anne called a woman she knew from school who worked
for Stewart Biotech and, under the pretext of doing some freelance
research for someone, asked her for any names that might be in the
Biotech files of programmers who specialized in writing software for
scientific applications.  She got back a dauntingly long list of 145
names.  Over a period of days she reached all but three of the names by
telephone.  They, in turn, f gave her other names to call.  She
eventually talked to over three hundred programmers.  None of them had
ever worked for Harold Goth.

After three weeks of effort, the task began to seem hopeless.  A
programmer could be lying to her, fearing that any past association
with Goth might be harmful.  Or the individual who wrote Jupiter might
not have specialized in scientific applications at all.

That would open the door to thousands of other possible candidates.

Anne was about to give up altogether when she came across a copy of a
genetics textbook in the New York Public Library that Goth had written
fifteen years earlier.  There were a few paragraphs in the book that
dealt with the importance of computer technology in applied genetic
research.  A footnote at the bottom of the page credited a man named
Axel Guttmann of Stanford University for some of the technical
information.  Goth, she remembered, had once held a teaching post at
Stanford.

She called the head of Stanford's biology department, a woman named
Margaret Contardi.  Axel Guttmann had indeed worked there, Contardi
said.  She also remembered that he had worked with Goth on some project
or other; she couldn't recall what it was.  It was a long time ago.

Guttmann was a wizard with computer languages, Contardi told hen-and
particularly good with scientific applications.

"Is Professor Guttmann still at Stanford?"

"Oh, no.  He left years ago."

Anne's heart sank.  "Do you know where he went?"

"I'm not sure.  I think he took a job with the federal government.

With the military or some federal agency.  I don't recall any more than
that."

After dozens of calls to different branches of the federal government,
Anne finally located someone at the National Institutes of Health at
Bethesda, Maryland, who remembered Guttmann.

"He did some classified work for the Department of Energy," a deep male
voice replied.  "I think he's at IBM now."

Anne called the Poughkeepsie headquarters of IBM.  After a wait for the
switchboard to route the call to his extension, she found herself
talking directly with Axel Guttmann.

Guttmann admitted that he had known Goth.  Beyond that, he wouldn't say
much.  But he was willing to talk to her.  He invited her to come to
Poughkeepsie--and to bring the Jupiter program with her.

The following Sunday, Anne left Genny in Mrs. Callahan's care and
drove up to IBM headquarters in Poughkeepsie, an hour and a half north
of Manhattan.

She found Axel Guttmann waiting for her in the nearly deserted main
lobby of one of a cluster of buildings that made up the IBM campus.  He
was big, with a florid face, masses of black hair, flashing dark eyes
under eyebrows as thick as brushes, and a big black handlebar mustache
over a mouth of big teeth with a great deal of gold inlay.

Incongruously, he was dressed in a cheap white shirt, nondescript
wrinkled gray trousers, and black shoes.  A German-Czech refugee who
had emigrated to the United States in 1968, after the Prague Spring, he
looked like a Gypsy king whom someone had stuffed into the drab uniform
of a computer nerd.

His eyes betrayed a surprising furtiveness.  They were constantly
moving and shifting, as if he were afraid something unpleasant might be
creeping up behind him.  Anne wondered if this was a legacy of his
years under communism or simply a nervous habit.

He greeted Anne with elaborate continental politeness, obtained a
visitor's pass for her, and ushered her down the empty corridors to his
office on the second floor, a cramped, windowless space in a state of
disarray so chaotic that Anne's first impression was that it had just
been burglarized.

Guttmann removed a teetering stack of paper and books from a chair and
invited her to sit.  He plunked himself down in his own chair, in front
of a glowing computer screen.  Only the screen was visible.  All
adjacent surfaces, except for a detached keyboard, were totally buried
under paper.  Anne wasn't even certain that Guttmann had a desk at
all.

"I apologize for the grossly untidy state of affairs," he said, with a
self-deprecating grin.  "The management threatens to fire me
regularly.

Of course they won't, because I'm the only living human who knows where
everything is in here.  And for that same reason, I dare never clean it
up, lest I render myself dispensable in the process."

Guttmann's eyes, which had been focused lingeringly on Anne's breasts,
finally noticed the thick manila envelope she was carrying.  "I see
that you're treating the package in your right hand with extreme
care.

I can only guess that it contains the program you're so eager to have
me examine."

Anne handed Guttmann the envelope.  "I very much appreciate you taking
the trouble."

Guttmann busied himself pushing aside boxes and stacks of manuals to
locate a bay for the RCD in the computer tower hidden somewhere under
his desk.  He found one, finally, and sat back with a sigh of
contentment.  "This may take a minute," he warned, settling the
keyboard comfortably in his lap.

Anne sat silently while Guttmann explored the contents of the Jupiter
disk.  His fingers flew over the keyboard in a blur of clicks,
interspersed with an occasional grunt of impatience.

"It's Goth's baby, all right," he said, not pausing in his
keystrokes.

Screen after screen of data flickered by.

Suddenly Guttmann banged both fists against his head and uttered a
booming shout that made Anne jump.  "And it's vintage Axel Guttmann,
too!"  he exclaimed proudly.  "I know my algorithms when I see them."

He swiveled around in his chair.  "I wrote it.  Most of it, anyway.  It
took a few months out of my life, I can tell you.  I never finished it,
though.  Goth just disappeared one day.  I never saw him again, never
heard a word from him.  I learned later that Stanford had fired him.

And by that time he could probably write program code as well as I
could.  He was a fast study, that Goth.

It's incredibly complicated stuff--so many evaluations to make, so many
kinds of criteria.  And so much data to crunch.  I almost went out of
my mind trying to make my humble computer languages perform the kinds
of four-dimensional acrobatics that Goth expected.  But I did it.

I forgot how good I was.  But Goth himself--he was crazy, I think.  A
genius, of course, but obsessed.

He must have finished this himself."

Anne explained the genetic trials she had run with Jupiter.  "I could
never get a match.  The program seems to function fine, but the results
I get are consistently wrong."

Guttmann laughed.  It was a barroom guffaw, as if he had just been told
a great dirty joke.  "Of course!"  he exclaimed.  "Goth was a maniac
about secrecy.  I don't know much about genetics, you understand, but
it was clear to me that Harold thought he was on to something big with
these new procedures he was developing.  He was very arrogant about
it.

He even made me sign a piece of paper swearing I'd never divulge
anything about the nature of the work I'd done for him."  Guttmann
paused, then continued in a quieter tone.  "I never did, either.  But
now that he's dead, I guess it no longer matters."

Anne was completely puzzled.  "What do you mean?"

"Access codes," Guttmann explained.  "He always used codes.

He drove me up the wall with his goddamned codes."

"But I was able to operate the program.  And so were you."

Guttmann patted Anne gently on the knee.  The gesture startled her, and
she tensed.  "Of course .  . . of course," he said.  "And you got
terrible results!"

"Yes, but--" "Goth used a silent code.  It doesn't prohibit access.  It
does something better.  It lets you go right ahead and use the program,
in complete ignorance of the fact that your failure to initiate with
the correct code renders all your results useless--completely
useless!"

Guttmann moved his head closer and stared right into her eyes.  "A
silent code is the best protection," he continued, in a soft voice.

"It encourages the would-be intruder into believing he's broken into
the program, when in fact he's being hoodwinked.

It's as if you cracked a combination safe on the first try, took out

,.

A l

I

l

:."  .

"

I

:. ,.:

.1 ,'P.:

the valuables, and found out later they were all fake and sprayed with
a lethal poison to boot."

"Then how do you access the program properly?"

Guttmann flashed his gold inlays.  "You have to know the access code,
of course."

Anne felt the now familiar sense of impending frustration and
despair.

"But that could be anything, couldn't it?"

Guttmann nodded.  "There are millions of possibilities."

"But just now, you searched all through the program, didn't you .  .

.

?"

"Hah.  Yes.  Of course.  I was studying the program code--the lines of
instruction written in computer language.  In this case, Language C.

Very powerful.  It's used in a lot of scientific applications."

Anne bit her lip.  Guttmann was making her nervous.  Despite absolutely
no encouragement, he insisted on trying to flirt with her.  "I don't
know anything about the architecture of computer programs," she
replied.  "But how could you have looked at all those lines of program
without knowing the access code?"

Guttmann produced a self-satisfied little chuckle.  "Oh, I do know
it.

I typed it in at the sign-on.  You can hit the Return key at that
point, as you've obviously been doing, and get your bogus results, or
you can enter the correct code.  That's what I did."

Anne laughed.  She felt a rush of triumph.  Her effort was finally
beginning to pay off.  "Are you sure it's right?"

Guttmann chuckled again.  "Oh yes.  Goth always used the same word as
his access code.  I used to kid him about it, telling him he was
defeating his own purpose by being so unimaginative.  But it had some
special significance to him, it seemed.  And I suppose he figured that
since I was the only other living human being that knew what the code
word was, that it would remain perfectly safe."

Guttmann removed the RCD from his computer and handed it back to
Anne.

He closed her fingers around it with his other hand.

Anne slipped it back in the envelope.

"Well .  . . what is it?"  she asked.

Guttmann showed his gold teeth again.  "First, I have a question for
you."

"Yes?"

"How do you come to have this program?"

Anne had thought out in advance what she should say.  She hated to lie
to anybody; but in this situation, extreme caution was obviously called
for.  Guttmann didn't seem at all aware of the controversial nature of
the program; neither did he appear to know that it had led to Goth's
death.  So the complete truth was out of the question.  "Goth sold it
to a company that my husband owns.  That was just before he died.  Now
my husband's trying to figure out exactly what he owns.  Since he can't
go back to Goth, he's asked me to look into it."

"What does your husband intend to do with it?"

Anne smiled brightly.  "Nothing at the moment.  He just wants me to
help him determine whether or not it has any value."

"Does it?"

"Well, we're not sure, yet."

Axel Guttmann poured on more questions, and Anne had trouble trying to
fabricate persuasive answers.  His sudden curiosity alarmed her.  She
couldn't tell if he was genuinely suspicious of her or just trying to
keep her there.

He finally ran out of questions.  It was Sunday, the place was empty,
and Guttmann just sat there, staring at her, his eyes appraising her
body with a rude frankness.

"So will you tell me the code word?"  she asked.

"I'm not sure," he replied.

"Oh?  Why?"

"I think I might need a little persuasion."

Oh God, Anne thought.  "If you're thinking of some financial
consideration," she said, "I'm sure we could arrange something--' "I'm
not," Guttmann interrupted.  He wet his lips with his tongue.

"No ?  Then what .  . . ?  " "I was thinking of a more personal
consideration.  A little exchange, you might say.  I give you what you
want, and you give me what I want...."  He let his sentence trail off
suggestively.

; You creepy bastard, she thought.  It was clearly time to leave.

Anne got quickly to her feet and held out her hand.  "Well, thank you
for your time," she said in a cold voice.  "If you change your mind
about money .  . ."

Guttmann remained in his chair.  He grabbed her hand and grinned at
her.  "I'm not going to change my mind."

She tried to pull her hand back, but his grip tightened.  He yanked her
toward him.  She lost her balance and fell forward onto his lap.  He
locked his arms around her waist and neck and pressed his mouth against
her lips.  His tongue slithered against her teeth, trying to pry them
apart.  A hand squeezed her breasts, and she felt his penis bulging
against her thigh.

Guttmann was strong and determined.  Screaming out in a deserted office
building would be a waste of breath.  She opened her mouth to allow
Guttmann's probing tongue partway in, then bit down hard.  He fell
back--shocked, astonished.  He groaned, then clapped a hand over his
mouth.  Blood oozed between his fingers.

She pulled free of his lap and started to run.  He caught her and spun
her around.  She brought one foot up swiftly.  The toe of her sneaker
met the middle of his groin with a solid thud.  He gasped, staggered,
and doubled over.

e didn't seem inclined to pursue his attack, but Anne didn't wait
around to find out.  She tucked the envelope with the RCD under her arm
and fled from the building.  She ran to her car in the parking lot, got
in, slammed and locked the door, and sat there, trembling violently
from the fear and anger boiling in her blood.

When she felt calm enough to drive, she started the car and headed
slowly back for Manhattan.

She was happy she had fended him off so decisively.  But the encounter
depressed her.

Giving into Guttmann's demands was out of the question.  But how else
was she ever going to get the access code from him?

It was an exclusive gathering.  The baroness had chosen the twenty
couples from an initial list of two hundred.  Each couple was being
charged the equivalent in German marks of half a million dollars to be
the first to participate in the program.  They had all been interviewed
several times, and their medical, social, and financial histories taken
down in detail.

They were all rich and well connected.  Five couples were from Germany,
five from France, four from England, two from Italy, and one each from
Spain, Austria, Sweden, and Switzerland.  The youngest woman in the
group was twenty-four; the oldest, thirty-five.  Three of the husbands
were titled nobility; two of them were billionaires.

Dalton Stewart had played no part in their selection.  Nor had he
sought any.  He was content to let the baroness stick her neck out for
this first round of customers.  If Jupiter worked as advertised, he
expected to initiate the second round with a group of Americans.

The baroness had been careful to understate Jupiter's promise.

The couples had been told that they could expect mentally and
physically superior offspring, and that was all.  They were at Schloss
Vogel for a series of informal talks on the procedures they were to
undergo the following week at the clinic in Romania.

As the guests arrived, they were shown to their bedrooms-large,
spacious suites on the upper floors of the castle.  Later, the baroness
conducted them on a tour through the 250-year-old

314

..

building's seemingly endless spaces: the huge Hall of Knights, with its
display of medieval armor and weaponry; the baroque chapel, with its
enormous stone arches; the grand salons; the two story-high dining hall
with its tapestries and balconies; the tower rooms; the ramparts; the
arsenal; the keep.

The dungeon, located at the bottom of a long circular stone staircase
several levels below ground, was especially popular.  The guests
inspected the various medieval instruments of torture with

J."  avid curlosity.

The center of attention was something called the "little maiden," a
modified version of the infamous iron maiden.  The iron maiden was a
giant iron box about the dimensions of a large coffin stood on end,
with a hinged door on the front.  The insides of the back and the door
were studded with hundreds of long, sharp iron spikes, so that when a
victim was put inside and the lidlike door screwed closed, the spikes
would pierce his flesh from head to toe in hundreds of places.  The
little maiden differed in that her spikes were considerably shorter.

It was possible, unless one was very fat, to stand up in it with the
door closed without a single point touching one's skin.  The little
maiden was considered a more effective torture because of the exquisite
mental duress it inflicted on its victim.  Some were able to hold out
for hours before finally collapsing against the spikes.  Amid a great
deal of giggling and laughter, several of the guests got inside and had
the door closed on them.

But Schloss Vogel's biggest attraction was its ingenious network of
secret passageways.  The baroness passed out flashlights and took the
guests through the main one--a three-level passage twenty inches wide
inside the interior walls of the main section of the castle.  One
entered the passage through a hidden doorway in a basement closet,
climbed a long flight of extremely narrow steps to the second floor,
then walked along a kind of gallery past a row of small wooden doors
that gave access to a row of bedroom suites on the castle's south
side.

The doors were cleverly hidden in the wood paneling in the bedrooms,
and each one contained a small peephole.

The gallery then took a ninety-degree turn and continued inside the
inner wall on the western side of the building.  At the end of this
first gallery another narrow flight of stairs led up to a similar
gallery on the floor above.

The main part of Schloss Vogel had been built by Baron Hugo von
Ullricht in 1752.  He included the passageways so that he could spy on
his guests.  Legend had it that several rivals met with mysterious
deaths during overnight visits to the Schloss.  The castle was added
onto by subsequent members of the family, and the custom of building in
secret passages continued.  A later Baron von Ullricht was said to use
them to visit the bedrooms of various mistresses without raising a
scandal.  The last Baron von Ullricht, who occupied Schloss Vogel until
1923, was reputed to be in the habit of spying on his guests as a
sexual diversion.  In 1923, the baron's wife was murdered in her
bedroom under circumstances that strongly suggested that the baron was
responsible.  Many believed that during his voyeuristic rounds he had
caught her in bed with another man.  The police failed to bring charges
against him, but the murder ruined him socially.  He sold the castle to
the von Hausers and moved to South America.

The baroness had spent a fortune restoring the estate.  She had also
spent a fortune on security.  A high wall encompassed the entire
thousand acres, and it was electronically monitored around the clock.

No one could get over the wall or through any of the three gates
without his presence being detected immediately.  Not that anyone would
want to.  A couple of dozen Dobermans and Alsatians--all trained attack
dogs--were turned loose to roam the property every night.  Anyone
caught on the castle grounds after dark was in trouble.

With these guests the baroness wasn't taking any risks.  The dogs would
be kept securely locked out of sight in their kennels for the
weekend.

A security force of twenty men had been brought up from the Hauser
plant in Regensburg to fill in for the dogs.

After the tour, the baroness hosted a get-acquainted cocktail party.

Most of the public rooms in Schloss Vogel, with their huge fireplaces,
deep stone window casements, and high walls of stone or dark wood, were
predictably gloomy and medieval in feeling.

For this first formal gathering, the baroness had picked one of the
brighter chambers at the end of the south hall.  She had had all the
heavy wood furniture, stuffed animal heads, and coats-ofarms removed
and the space redecorated in light colors, with overstuffed casual
sofas and chairs, bright pillows, throw rugs, end tables, floor lamps,
and wall tapestries depicting pleasant pastoral scenes.  Huge vases of
flowers lightened the darker corners, and large mirrors reflected and
magnified the light, giving the otherwise somber hall a cautiously
festive atmosphere.  Drinks and canapes were served by an attentive
group of waiters.

Dr. Laura Garhardt and three other members of the team of
obstetricians and geneticists who were to perform the work were present
to explain procedures and answer questions.  The baroness knew that a
success with this initial group was critical.  They could be counted on
to spread the word quickly among their friends.

For the same reason, failure could be disastrous.

The baroness, looking spectacular in a floor-length red gown, welcomed
the group with a calculated dose of flattery.  She congratulated them
on being chosen for this historic event, and praised them for the
pioneering role they were about to embark upon, and the enormous
contribution their sacrifice was going to make to the noble cause of
science.  She detailed the weekend's events, and then introduced Dalton
Stewart.

He added a few welcoming remarks of his own, including a brief and very
sanitized description of how this remarkable genetic program had come
to be developed.  It was still somewhat experimental, he warned, and of
course it remained highly secret.

But he reassured them that so far their results had been
extraordinary.

"Just how extraordinary I'll now demonstrate," Stewart said.

He glanced expectantly to his right, where one of the waiters had
uncovered a large TV screen.  All eyes in the room turned to follow his
gaze.  The screen flickered to life, and the guests saw a beautiful
little girl playing the piano in a large, sunny room.

"This is Genevieve," Stewart began.  "She'll be three years old on
January first.  She was the first child conceived under this program.

And I am very proud to tell you that she also happens to be my
daughter...."

He spoke slowly, giving the baroness time to translate his remarks into
German and French.

"This scene was shot at our home in Long Island," Stewart continued.

"Genny, as we call her, has never had any piano lessons.  She plays
entirely by ear.  If she hears a song once, she can reproduce the
melody perfectly.  Of course, her hands aren't yet large enough for her
to reach all the keys, so her chord accompaniment is necessarily
limited."

After a few minutes of piano, the camcorder cut to a new scene, showing
Genny reciting by memory in a child's singsong tones a passage from
Shakespeare's The Merclant of Venice.  The third scene showed Genny
being handed a children's book by her nanny, Mrs.  Callahan.

"You've never seen this book before, have you, Genny?"

Genny looked the book over.  "No, ma'am, I have not," she responded in
a very adult and authoritative tone.  The guests chuckled
appreciatively.

"Then turn to page five and read what it says there, please," Mrs.
Callahan said.

Genny turned to page five, studied it with a concentrated expression,
then began reading the words out loud: " 'Isn't it funny how a bear
loves honey.  Buzz, buzz, buzz, I wonder why he does."

Hey," she added.  "It rhymes!"

The guests laughed.  Stewart saw the amazed delight on their faces.

He continued his narration through several more taped scenes.

One showed Genny climbing through a jungle gym and swinging on a
trapeze bar.  It was immediately apparent that her speed, grace, and
agility far surpassed what would be expected from a child of three.

Genny's mother was conspicuously absent from the video.

Stewart had recorded all the scenes at his Lattingtown estate during
one of the weekends Genny was in his custody.

Stewart made a few closing remarks about Genny's high IQ t

1

,

.

';

:

4i'

';.

:'

''',

_, .s, '";

i':

and robust health, and the probability, based on the genetic
enhancements of the program, that she would live to be a hundred or
more.  He apologized for not being able to have his daughter there with
him in the flesh, but promised that they might well meet her in the
near future.  No mention was made of Genny's heightened sensory
acuity.

Stewart himself remained unaware of it.

Following the video presentation, the guests were ushered into a lavish
banquet in the castle's enormous dining hall.  Despite their worldly
sophistication, they were all quite astounded by what they had seen and
heard.  The dinner table buzzed with enthusiastic talk about Genny
Stewart, the program, and their own imminent participation in it.

The guests inundated the baroness, Dr. Garhardt, and Dalton Stewart
with questions and praise for several hours, and went off to bed,
finally, sated and weary, but excited.

Later, Dalton Stewart found the baroness in her upstairs study.

"I'm going back to Munich tonight," he said.

The baroness had changed into a melon-colored peignoir and done up her
hair.  She was reclining on a small chaise and studying what looked
like a financial report of some kind.  She looked up at him.  Her light
blue eyes seemed to examine him with unusual intensity.  It was a look
he had seen before: concealed anger.  "It's late," she said.  "You
should stay."

Stewart shook his head.

She picked up a black plastic RCD from the end table beside her and
handed it to him.  "We finally received your copy of Jupiter from New
York.  I have it right here."

Stewart took it and looked at it, confused.  "Did they encode it
already?"

"It's blank."

"What do you mean?"

"There's nothing on it.  No Jupiter program.  It's blank."

"Somebody sent the wrong cartridge, then."

"No.  This was the only one in the safe in your office.  That's what I
was told."

"That can't be.  Did you speak to Hank Ajemian?"

"No.  I'd like you to."

"I will."

"Because I believe he has stolen it."

"Nonsense."

"Does anyone else have access to your safe?"

"No," Stewart replied, raising his voice.  "But if Ajemian were going
to steal it, he'd have made a copy, for chrissakes, not sent you a
blank.  He's not stupid."

The baroness stared at him.  Obviously she didn't believe him.

She waited a few beats and answered him in a soft voice: "All I know is
that your copy is now missing."

"I'll talk to him.  There must be a simple explanation."

"I hope so.  You realize this could ruin everything."

"I'll talk to Ajemian tonight."

Stewart left the baroness and drove back to Munich.  By the time he
reached his apartment, it was two-thirty A.M. It would be eightthirty
P.M. in New York.  He dialed Ajemian's home number.

He answered after eight rings.

"It's Dalton.  We've got a problem."

"I could have guessed."  Ajemian sounded depressed.

"The RCD you sent to Munich--the baroness says its blank."

"That's not possible."

"Did you check it?"

"No, but no one else can get into the safe."

"Is it possible it was already blank when I put it in the safe?"

"I don't think so."

"Well, the baroness thinks you stole it."

"That figures.  She's been dying to nail me on something."

"What else could she think?"

"Maybe she's lying.  Did you check the RCD yourself?"

"No."

Stewart pressed a hand against his forehead.  He had a sharp
headache.

"I don't know what the hell to think, Hank.  I was hoping maybe it was
a mix-up.  That you took the cartridge out to make a copy before
sending it over here, and then you just sent the wrong RCD."

:",

"I did copy it--just to protect us.  But I'm positive I sent over the
one that was in the safe."

"Did you check the copy you made?"

"No.  But I will, as soon as I get into the office."

"Couldn't you have switched them by mistake?"

"No.  And if the one in the safe was blank, then my copy will be
too."

"Will you check it?"

"I said I would."

"Let me know right away."

"A blank RCD's not your only problem," Ajemian said.  "Unless we can
renegotiate a better repayment schedule out of her than the one you
agreed to, Biotech is going to default."

"I'll take it up with her."

"Do more than that.  Get us better terms."

"I'll do what I can.  Just find that RCD, Hank."

There was an awkward silence.  Finally Ajemian spoke.  "Get out of
there, Dalton, for chrissakes.  Before it's too late.  Cut your
losses."

"Just find that goddamn missing cartridge!"

Stewart dropped the telephone receiver back onto its cradle and sank
down onto a sofa.  He felt an overwhelming fatigue.  He propped his
elbows on his knees and rested his head in his hands.

If Ajemian couldn't find the copy, then all copies of Jupiter would now
be in the baroness's hands.

He was damned if he was going to let her cut him out of Jupiter.  He
had to do something.  Thank God at least he still had Genny.

Anne surveyed the narrow, cramped apartment room she had converted into
a study.  There was a desk with a computer and a printer on it, a small
table stacked high with manuals, RCD cartridges, and journals, and two
bookshelves so crammed with books that it was physically impossible to
wedge one more in, vertically or horizontally.

She had been working here on her own for months, trying to unravel the
mysteries of the Jupiter program.  The effort had given her an
immediate sense of purpose, and had helped keep her from brooding about
her failed marriage and from worrying about the future.

Now, thanks to Axel Guttmann and a one-word access code he refused to
divulge, her effort seemed at an end.  For the past three days she had
wrung her hands in anger and frustration, trying to come up with some
plausible way she might still get Guttmann to give her that one crucial
word.

She had asked Lexy for help, but Lexy's advice always came back to the
same thing--give Guttmann what he wanted.  For a while she had
seriously considered it.  But even if she could overcome her loathing
long enough to submit to him, she had to reckon with the possibility
that he might try to string her along indefinitely, or even mislead her
with phony code words.  And there was always the possibility that he
might be dangerous as well as loathsome.

322

j ."

;

The only other approach was to try to guess what the code word might
be.

She had tried the obvious words, like "Jupiter," "Goth," "Genome,"
"Nobel," and "DNA," hoping for a lucky break.  Each attempt was tedious
and time-consuming, since it required testing each new word by feeding
her genome and Dalton's genome into the database all over again and
seeing if she got a result that matched Genny's genome.  She knew the
effort was futile.  There were just too many possibilities.  The word
could be the name of someone Goth knew.  It could be a nonsense word.

It could be anything.  She could spend years trying to find it.

But she couldn't let it alone, either.  Each day, she'd come back to
the computer and try a few more, hoping for a miracle.

She reread all Goth's published works, underlining words he seemed to
use often, making lists of names and subjects and places and anything
else that potentially interested him, looking for some pattern that
might at least let her narrow her search.

After days of fruitless effort, she was taken by a new inspiration.

She remembered having seen a copy of a book with a title something like
The Complete Guide to Sherlock Holmes in Goth's laboratory at the
hospital in El Coronado.  It was the only book she ever saw in his
vicinity that related to anything other than the subject of genetics,
and it had surprised her.  He had also said something about being a fan
of Sir Arthur Conan Doyle's.  Maybe he had picked his code word from
one of Conan Doyle's stories.

It was a thin reed of hope, but it was better than nothing.

Anne went to the public library and checked through everything
available by or about Arthur Conan Doyle.  There was quite a list.

She took home half a dozen books, including The Complete Sherlock
Holmes, and started reading them.

Anne had never read anything by Conan Doyle, and her only acquaintance
with Sherlock Holmes came from snatches from old Basil Rathbone movies
she had seen her mother watching on television a long time ago.

After reading a few of the stories, she began to see how Goth might
have identified with Holmes.  They were both puzzle solvers of sorts,
and they were both loners--maverick geniuses who had little patience
for society's conventions.

She thumbed through several guides, reading short summaries of the many
tales involving the great detective and his friend Watson.  She was
sure she was on to something.

Several days and two hundred potential code words later, her optimism
faded.  She might have narrowed the search, but she had not narrowed it
enough.  There were still too many possibilities.

She skimmed through Goth's writings again.  They were all about
genetics.  And they were all written in a dense, turgid style, using
language even scholars in the field would have found daunting.

Anne tried another hundred words, but the right one continued to elude
her.  She shut the door to the study and didn't go back inside for a
week.  She spent the entire seven days with her daughter, who had begun
to feel neglected.

When the week had passed, she opened the door to the study again, not
sure what she intended to do.  She glanced around the :lisordered mess
of books and papers.  Immediately that familiar sensation of
frustration and futility began to overwhelm her.  She backed out of the
room, shut the door again, and walked down the hallway toward her
bedroom.

She stopped suddenly.  She walked back to the study door, opened it,
and peered inside.

The book had caught her eye before but had failed to register its
message on her consciousness.  Now it did.

It was jammed sideways on top of the tightly packed row of books on the
top shelf of the bookcase nearest her desk.  Its title was The Double
Helix.  Written thirty-four years earlier, it described the discovery
of the shape of the DNA molecule and opened the door to the eventual
breaking of the DNA code itself.

It was a classic in the scientific literature.  Anne had read it in
college.

There were two authors.  One of them was an Englishman named Francis
Crick.  The other one was an American--a scientific maverick not unlike
Goth.  Goth had cited him frequently in his own writings.  His name was
James Watson.

I

I

'

' '

E

y

;

;^, .

.

.

'''J

'

She felt a slight tingling.

Watson.

The same last name as Sherlock Holmes's erstwhile companion, Dr. John
Watson.

The same initials, too.  One had been a medical doctor, the other a
scientist.  Goth had been both.  It could just possibly be, she
thought.  Simple, obvious.  Probably too obvious.  And hadn't she
already tried the word "Watson"?  She couldn't remember.

Anne turned on the computer and waited for Jupiter to boot up.  She
balled her hands into nervous fists.  She had been disappointed so many
times before.

At the prompt Anne typed "WATSON" and hit Return.  "Please let this be
right," she whispered.  "Please."

Nothing unusual happened.  The program displayed the identical prompts
as it had always displayed.  She caught her breath.

Maybe nothing different was supposed to happen.

She worked her way through Jupiter's long list of options, fed her
genome into the database, and repeated the process with Dalton's
genome.  When the program finally began printing out its new genome,
she was afraid to look at it.  She pressed her hands against her eyes
and took several deep breaths.  She uncovered her eyes, finally, and
stared at the printout.  This time Jupiter had answered with an exact
duplicate of Genny's genome.

She felt breathless.  She had just reproduced the identical blueprint
that Harold Goth had used to alter the genetic code of the fertilized
egg he had implanted in her womb almost four years ago.

Anne went out to the kitchen refrigerator.  It was one o'clock in the
morning and she suddenly realized she was ravenously hungry.  She
opened a bottle of Pinot Grigio and consumed half of it, along with a
leftover bean salad that Mrs. Callahan had made, a turkey drumstick, a
small carton of yogurt, and a wedge of Camembert.

She went to bed that night in a kind of giddy, astonished euphoria, as
if she had just won the Nobel Prize and couldn't quite believe it.

The excitement of her accomplishment died the next morning.

Despite her discovery of the access code, she realized she still had no
understanding at all of how Jupiter achieved its results.

And trying to improve that understanding quickly became as formidable a
task as finding the code word itself had been.  She spent more weeks
analyzing the genetic script of Genny's genome.

She tried to determine which genes Jupiter had copied whole from one
parent, which ones were the result of recombination (a mixture of both
parents' genes), and which, if any, Jupiter had created on its own.

When Anne wasn't bent over her computer, she was buried behind growing
stacks of textbooks and scientific journals.  She checked so many
volumes out of the medical library at Columbia University that one of
the librarians complained about it.

She begged and borrowed sample genomes--normally prohibitively
expensive items--from wherever she could.  Some came from some of her
old biology professors in college and others from people she had worked
with at the Vermont laboratory now owned by her husband's parent
company, Biotech.

With these extra male and female "parent" genomes she used Jupiter to
create several dozen new "son" and "daughter" genomes.  With these
additional genetic blueprints she could make comparisons and begin to
isolate patterns in Jupiter's manipulation of gene structures.

Two problems threatened to derail her from the start.  First was the
tremendous complexity of the subject itself.  She frequently felt on
the verge of losing her intellectual grasp of it.  Her feelings about
Goth and genetics in general underwent constant shifts: one day she
would be frustrated and confused beyond endurance; another day she
would be overcome with awe and admiration at the magnificence of it
all.  She would marvel at how anything as complex and as elegantly
designed as life could ever have come into existence.  The more one
knew about genetics, she thought, the more necessary it became to
believe in God.  Chance and evolution alone could not possibly account
for such a dazzlingly intricate cascade of miracles.

The second problem was the absolutely staggering amount of data
involved.  Along the spiral ladders of DNA that made up each human
genome there were those three billion individual base pairs of
nucleotides.  About two billion of them served no known function.  The
remaining one billion made up the individual genes that determined the
sex, shape, size, color, personality, intelligence, and every other
aspect of each individual of the animal species Homo sapiens.

b Some of the genes were quite simple and straightforward in the
functions they performed.  The roles of others were either still hotly
debated or unknown.  Some genes were quite small, containing only a few
thousand base pairs.  Others were enormous agglutinations several
hundred thousand base pairs in length.  And the alteration of a single
base--the change of the sequence ATTC to AGTC in a certain location in
the overall sequence, for example--could completely alter the
functioning of the entire gene, even shut it down altogether.  The
knowledge of what precise alterations in which genes caused what
changes in the function of the genes was the basis of the whole science
of genetic engineering.  Hundreds of thousands of experiments had been
conducted, hundreds of thousands of papers had been written to this ',n
end, and still so much remained unknown.

Without the high-speed computer and sophisticated software that could
catalogue, analyze, sort, cross-reference, and manipulate tremendous
amounts of data in milliseconds, Anne would not even have been able to
begin her quest to understand Jupiter.  But even with the help of this
advanced equipment, the mysteries of Goth's program--how he had been
able to extract from the human genome the kinds of extraordinary
functions she saw in operation in her daughter every day--continued to
elude her.

Anne felt reasonably certain that Jupiter must call for some unusual
alterations of some genes somewhere, but so far she had been unable to
find even one.  A special genetics screening program, a copy of which
she had borrowed from the lab she once worked for in Burlington, had
combed repeatedly through the sequences of Genny's genes and failed to
find any marked alterations in the arrangements of the base pairs.  It
had also failed to find any in the other Jupiter-created genomes.

Every one of the gene sequences analyzed--and the screening program had
analyzed over a hundred thousand--came out as either a duplicate of one
of the parent genes or a combination of both, and all were well within
the accepted parameters of the patterns of genetic inheritance.  It was
maddening.  Anne couldn't extract even a hint as to how Genny could
possess such extraordinary faculties.

Genny's eyesight, for example.  Anne knew from the tests Paul Elder had
administered that her daughter could see across a broader band of the
light spectrum than normal.  Yet none of the genes that controlled
Genny's eyesight showed any abnormalities.

In fact they were exactly the same as Anne's, base pair for base
pair.

Logically, then, Genny's eyesight should be within the normal range,
the same as Anne's.  But it wasn't.

No unusual sequences of base pairs--or evidence of any additional
sequences--appeared on the genes responsible for the functioning of
Genny's other senses, either.

Anne considered one last possible solution to the mystery.  She had
read that widely separated and apparently unrelated genes, sometimes
even located on separate chromosomes, frequently worked in
collaboration.  So it was plausible that Genny's extraordinary
capacities were the result of new and unknown combinations of genes
working together.

Checking this theory out quickly proved to be a practical nightmare.

Every one of Genny's 150,000-plus genes had to be compared against a
series of genetic models that covered the known human genetic range.

After a month of exhausting labor, Anne managed to process only ten
thousand of Genny's genes.  The results: zero.  She had uncovered
irregularities in coding, but that was normal; human DNA was enormously
repetitive and redundant.  But in the crucial areas of protein coding
and control sequences, nothing unusual or suspicious had turned up.

At the rate she was progressing, she realized, it would take at least
two years to analyze the entire genome.  There must be a better way.

Lexy dropped in frequently, and occasionally they went out for lunch or
dinner.  But Anne was always impatient to get back to work.

"You're turning this into an obsession," Lexy told her.

"I have to know."

"Why?  What good will it do you?"

"Genny's not even three years old yet.  Her development's only
beginning.  Something could go wrong.  I've got to be prepared for it
if it does."

"Give yourself a break.  You've getting dark purple circles under your
eyes.  You look like your mascara slipped."

"I don't use mascara."

"And you're losing weight."

"Nothing wrong with that."

"Listen, Annie.  You've lost at least fifteen pounds in the last three
months.  Your ribs are beginning to show.  Make the damned thing
public.  Go to the press.  Lay it out.  Tell them about Genny.

Tell them what happened.  They'll eat it up.  Or go to the NIH.

Get the government involved.  Let the scientists who're supposed to
know what they're doing slave away on it for a while."

' "I'm doing fine by myself.  And going public would be crazy.  I have
to protect Genny.  And I want to stop Jupiter, not promote it.  It's
immoral to manipulate the design of human beings like this.  Not to
mention dangerous."

"You've told me that a thousand times.  I'm beginning to believe it.

But how does what you're doing prevent Dalton and that kraut Valkyrie
Baroness Brunnhilde von Mauser from developing it?"

Anne smiled.

"Is that supposed to be a gloating expression?"

"Jupiter won't work the way they're using it."  She revealed to Lexy
her discovery of the silent access code.

Lexy shrugged.  "How do you know somebody at Biotech or Hauser hasn't
figured that out already?"

"I seriously doubt they could."

"Well, let's celebrate, then.  You need some serious air and
refreshment.  There's a new Italian restaurant on Bank Street.

Let's go try it."

Anne looked wistfully at her computer screen, its rows of glowing amber
letters beckoning to her.  "I'm really not that hungry, Lexy."

"Damn it, do I have to force-feed you?  Come on!"

8

Anne made the breakthrough by accident.  Blurry-eyed and groggy one
evening after staring at the computer monitor for hours, she suddenly
realized that she could no longer understand the information on the
screen in front of her.

. She typed out "HELP."  She did it as a desperate joke--as a protest
at the ordeal Jupiter was putting her through.  Even though her
knowledge of the field of genetics had vastly increased from what it
had been only months before, it was mostly still so new to her that she
frequently found it necessary to stop what she was doing and consult
some reference or other in order to refresh her memory about a process
or a term.  The job was made all the more time-consuming and
discouraging by the fact that Jupiter had no manual to explain how it
worked.  Considering the size and sophistication of the program, it was
something of an accomplishment that she had learned how to operate it
at all.  But she constantly wondered if there might not be other things
it could do for her, if only she knew how to ask.

Jupiter had a main menu, but all it did was list, in the vaguest
language, the program's primary functions.  Within each of these
functions there were no help menus at all.  Goth--and Guttmann--had
designed the program for Goth's use; so explanations were apparently
not considered necessary.

So she just typed "HELP" and punched the Enter key.

The screen abruptly changed.  The rows of data were swept away and
replaced by a single query:

331

AREA ?

Anne stared dumbly at the word, not sure what to do next.  It had taken
her request for help seriously.  Why?  What had she been doing before
she had typed "HELP"?

She remembered that she had been copying data from a genome reference
book that listed all the known genes, their functions, and their
locations on the chromosomes.

She had decided that instead of plowing through the entire genome, she
would concentrate on the genes related to the senses.

This was the area in which Genny was most obviously different.

Anne had started with eyesight.  Using the reference book, she had
painstakingly typed into Jupiter's database the tags and locations of
all genes known to be associated with eyesight, so that Jupiter could
locate them in Genny's genome and call them up on the screen for her.

She had entered them all, but now she couldn't remember how many there
were supposed to be.  The reference book would tell her as soon as she
located the right page, but instead she decided to ask Jupiter.  She
typed out "How many genes?"  and hit the Enter key.

Jupiter responded immediately: FOR WHAT FUNCTION?

My God, she thought.  She had stumbled upon a whole new interface.

Jupiter was now really talking to her.

"Eyesight," she typed.

THERE ARE 4 GENES IN THE ALI SIGHT CLUSTER.

ENUMERATE ?

Anne shook her head.  That was clearly wrong.  She repeated the
question and got the same reply.  She picked up her reference manual
again and found in a glossary that the actual number of genes involved
with human eyesight was thirty-six.  A difference of six--not very
close at all.

She put down the book and stared for a long time at the message on the
screen: THERE ARE 4 GENES IN THE ALI SIGHT CLUSTER.  ENUMERATE?

Then it occurred to her.  She felt that same electric tingling
sensation she had felt the day she stumbled onto the code word
"Watson."

She typed "YES."

Jupiter immediately threw up on the screen specific chromosome
locations for forty-two genes: 13q46, 13q49, 13q56, 13q57, 13q58,
20q34, 20q37, and so on.  Anne printed them out and then checked their
locations off against the list in the reference manual.  When she was
finished she was left with the six genes unaccounted for in the
reference.  They were located at Xql2, Xql4, Xq24, 4q350, 4q370, and
4q371.

Anne tried the same exercise with hearing, taste, touch, and smell.  In
each area Jupiter offered up a list that exceeded the reference guide's
list by anywhere from six to ten genes.

When she had identified all the sensory genes not accounted for in the
reference book, she took a closer look at one of them.  She asked
Jupiter for a display of Xql2--one of the six unlisted sight
genes--located on quadrant 46 of chromosome 13.

Jupiter promptly displayed Xql2.  It was twelve kilobases long--a
medium-size gene.  Its function, according to Jupiter, was to code for
the production of a protein that would enhance the light-gathering
abilities of the cones of the eyes.  Anne printed out the entire
sequence of Xql2 and compared it with other genome printouts.  What was
immediately apparent was that the gene was located in an area where no
genes were known to exist.  The same was true of the five other extra
sight genes.  They were all to be found in sections of filler, or
"junk," DNA--long stretches of nucleotide sequences of unknown
purpose.

Goth seemingly had achieved his results not by altering existing genes
but by creating new ones.

But how could he have created them?  No one, not even a genetics genius
like Goth, could have possessed the knowledge required to fashion an
entirely new gene, let alone several whole new sets of them.  The state
of genetic engineering fell far short of such a capability.  Only God,
or the processes of natural selection, acting over millennia, could
accomplish such miracles--and then only by a prolonged process of trial
and error involving vast numbers of a species.

But the genes were obviously there.

Anne glanced over at her desk clock.  Did it really say two A.M.?

It seemed that she had just seen Genny to bed a few minutes ago.

She had been parked in front of the computer the entire day.  Her back
ached.  Her head was spinning and her eyes burned.  And she was
famished.

She turned off the computer, got up, stretched, and went into the
kitchen.  The insides of the refrigerator looked like an alien
landscape.  Almost everything in it had been put there by either Mrs.
Callahan or Lexy.

She found a slice of quiche and a nearly empty bottle of seltzer water
near the back of the top shelf.  She heated the quiche in the microwave
and ate it while standing over the sink.  The seltzer was completely
flat, but she gulped it down.

In bed, she couldn't sleep.  She dozed off briefly at around
threethirty and had a dream in which she met Dr. Goth in a laboratory
somewhere.  He appeared as a well-decayed corpse, able to move and
talk.  She wanted to ask him questions about the Jupiter program, but
he just grinned at her.  His bare skull was visible through the rotting
flesh of his face.  His eyes seemed to float in sockets of bone, and
there were no lips or gums around his teeth.

He was wearing what looked like an animal skin around his bony frame.

In one hand he brandished a large bone.  He looked like a relic from
the Stone Age.  He lunged at her suddenly, swinging the bone at her
head.

Anne sat up, trembling.  She pressed her face into her hands and rocked
gently back and forth, waiting for the remnants of the nightmare to
evaporate.  After a few minutes she slipped out from under the covers
and went over to check on Genny.  The child had kicked her blanket off
and was lying sideways across her bed.  Anne straightened her out and
covered her again.

She sat on her bed, fully awake now.

Jupiter would give her no peace.  She went back to the study and turned
the computer back on.

As soon as the program booted up, Anne asked it to call up one of those
extra sight genes--the one located at Xql2.  Next she directed Jupiter
to highlight the sequences that began and ended the gene.  Jupiter
obliged.  Anne studied the sequences, then checked them against several
reference sources.  They were precisely what they should be--promoter
sequences that carried the coded instructions necessary to turn a gene
on and off.

Anne printed out the entire sequence of the gene and then asked Jupiter
to call up her own genome and tell her how many sight genes it
contained.  Jupiter answered thirty-six.  She repeated the process with
Dalton's genome and several others she had at hand.

In all of them Jupiter found only thirty-six sight genes.

Anne then printed out the area of her own chromosome 13 that
corresponded to the location of the sight gene at Xql2 on Genny's
genome.  She did the same with Dalton's chromosome 13.  She aligned the
three printouts on her desk and studied them.  She expected to find the
whole twelve-kilobase-long sequence that formed Genny's extra gene
entirely missing from the other two printouts.  But that's not what she
discovered at all.  To her astonishment, all three of the printouts
showed identical sequencing, with one small but crucial difference: the
stretches of twelve kilobases on her genome and Dalton's genome were
not bracketed by promoter sequences.  Their genomes contained the same
gene as Genny's, but theirs were inactive.  Turned off.  Shut down,
like engines whose ignition systems had been removed.

The gene at Xql2 in Genny's genome was therefore not a new gene at
all.

It was an old gene--one that had been abandoned, probably tens of
thousand of years ago.  It was a vestige from mankind's prehistoric
past.  The human genome had long been assumed to carry chunks of its
heredity in the long stretches of inactive DNA, but no one had yet made
a thorough study of it.

Science had had its hands full the last two decades just trying to
determine the functions of the genome's active genes.

Anne repeated the same exercise with the other five extra sight genes
in Genny's genome and got the same results.

So Goth's great secret was not that he had invented anything new but
that he had discovered something lost.  He had salvaged old genes from
mankind's past--genes that evolution, for one reason or another, had
seen fit to abandon--and switched them back on again, using standard,
well-understood DNA control sequences.  And by so doing, he had created
Genevieve Stewart, a new human with extraordinary capabilities.

Anne recalled the bone Goth had wielded in her dream.  He had collected
prehistoric fossil remains--had left boxes of them behind at his old
laboratory in Coronado.  He must have extracted DNA fragments from
them.  That was probably where he had discovered these genes.

So Genny was not a new kind of human so much as she was a return to a
kind of human who must have existed a long time ago.  She was a kind of
throwback--yet a throwback markedly superior to the present model.

During mankind's evolution the genes responsible for these superior
abilities had been shut down.  Why?  Had their survival value been
lost?

It was no doubt true that senses as keen as Genny's were hardly
necessary in today's world.  They were perhaps even a handicap,
overloading the mind with more information than it could usefully
process.  But superior strength?  Health?  Intelligence?  They had
enormous survival value.  Why had they declined?  Was mankind somehow
gradually weakening its own gene pool?

And what other vestigial genes might Goth have reactivated?

Anne asked Jupiter for a total gene count of Genny's genome.

Jupiter gave the number as 150,826.  She called for the totals in her
genome and Dalton's.  The numbers came back the same for both:
150,022.

That meant Genny was carrying 804 extra active genes.  Her additional
sensory genes totaled only 54.  That left 750 unaccounted for.  How
many of those could be devoted to enhancing intelligence, health, and
strength?  Certainly not all.

Anne thought about Genny's remarkable healing ability.  And her seeing
auras.  They no doubt accounted for some of the extra genes as well.

But could they account for so many?

What else was there hidden in Genny that hadn't yet surfaced?

It frightened her to contemplate the possibilities.

Anne yawned so hard her jawbone cracked.  She felt a profound
fatigue.

The implications of her discovery would take months to sort out and
digest.  Meanwhile, she wanted to sleep for a week.

The telephone rang.  She looked at the little clock by the computer.

Just six A-M- She fumbled for the receiver.  She felt so weak, so
crushed by the weight of her fatigue, it was all she could do to bring
the receiver to her ear.

"H'lo."

"It's Hank Ajemian, Anne.  Sorry to call so early."

"S'okay."  No point in telling him she hadn't really been to bed yet.

"How are you?"

"I thought I'd better call you."

"Something wrong?"

"Everything's wrong.  The baroness is taking over.  She's got control
of Jupiter.  In another month or so she'll probably have control of
Biotech as well."

"It doesn't really upset me very much, Hank."

Anne could hear a snuffle at the other end of the phone.

"They're accusing me of stealing a copy of Jupiter."

"I don't follow you."

"Remember I told you we keep a copy of Goth's program in Dalton's
office safe?  The baroness demanded it be sent to Munich ; to be
copy-protected.  She was just angling to get control of all the
copies.

I sent it, but before I let it go, I made another copy, just to protect
Dalton."

Anne felt suddenly short of breath.

"When they got their copy, they found it was blank.  Empty.

Nothing on it.  I couldn't believe it.  I thought they were lying.

Then I got out the copy I had made from it and put it in the
computer.

It was blank too.  The only possible explanation was that someone had
stolen the real copy from the safe and substituted a blank.  But Dalton
and I are the only ones with access to the safe.  Dalton had no reason
to take it, so naturally the baroness is convinced it was me.  But it
wasn't.  I don't know what the hell to do.  I think somehow she's
framed me, but I can't figure out how.  Nobody could get into that
safe.  Even if they knew its location and the right combination, they'd
still trip a burglar alarm.

Nothing had been touched.  I think that somehow the blank must have
been switched for the real one before we even put it in the safe the
first time.  But how the hell can I prove it?"

Anne struggled with her conscience.  She was too sleepy to think
straight.  But she knew she couldn't let him take the blame for
something she had done.  "I took the copy, Hank."

There was a prolonged silence at the other end of the line.

When Ajemian finally answered, he sounded more hurt than alarmed.

"Christ, Anne.  I wish you'd've told me.  How did it happen?"

Anne sighed.  Poor Ajemian.  Caught in the middle.  She had great
affection for him, but he still worked for Dalton, still looked out for
Dalton's interests.  She couldn't be completely open with him.

Reluctantly, she described how she and Lexy had broken into Dalton's
office and replaced the Jupiter RCD with a blank one.

Hank's gravelly voice became louder, sharper.  "Anne.  Listen.

Just let me come over and make a copy.  You can keep the one you
have.

I won't tell him you took it.  Just let me copy it.  I'll make two
copies--send one to Munich, put the other away for Dalton.  I'll tell
him there was a mixup.  It'll get me off the hook."

Anne smiled.  "Okay, Hank."

"Thank God.... Anne, you're an angel.  I'm so sorry you got mixed up in
this."

"I know."

"How's Genny?"

"Wonderful.  As ever.  More surprises every day."

"How are you doing?"

"I've been working on Jupiter."

"Working on it?"  Ajemian's tone was disbelieving.

"I've discovered a lot."

A few beats of silence.  "You have?  Like what?"

"Jupiter has an access code.  It won't work without it."

"You sure of that?"

"Quite sure."

"The geneticists in Romania must know that."

"I don't think they do."

"Do you know the right code?"

"Yes."

"How did you find it out?"

Anne didn't reply.

"Anne.  How the hell do you know this?  Who told you?"

"No one told me.  I worked it out by myself."

"Are you going to tell Dalton?"

"I wasn't planning to.  You can tell him if you want."

"You're kidding.  He won't believe it for a second."

Anne laughed.  "Well, just tell him I told you."  She could picture how
Dalton would take the news--how incredulous and angry he would be.

Sweet revenge.

"Then he'll know you have a copy of Jupiter.  And he'll assume I gave
it to you."

"Tell him the truth.  Tell him I stole it."

She heard Ajemian sigh.

"Well, tell him whatever you like.  I really don't care.  You know my
feelings.  I don't think anybody should have Jupiter.  I don't want
anybody else to be used as a guinea pig the way I was.  And especially
I don't want anybody using it just to make money."

"I don't know what to say, Anne."

"When are those Romanian babies due?"  she asked.

"About a month .  . . maybe less.  Are you positive it'll go wrong?"

"I'm pretty sure."

"What'll happen?"

"I don't know.  But the babies probably won't be normal."

"If I could tell Dalton something about Goth's code and how it works,
he might believe me.  You don't have to tell me everything, Anne.  Just
give me some plausible details."

"No," Anne said, her voice firm.  "I can't.  I'm sorry."

"But you know how Dalton is.  You've got to give me some plausible
evidence.  He won't believe for a minute that you could possibly know
anything about Jupiter."

"You're right, Hank.  He probably won't.  We'll let him learn the hard
way."

"You have to realize how desperate he is.  He's depending completely on
Jupiter to save him.  He doesn't have anything else.

If he thinks you hold the key, he'll do what he has to to get it from
you."

"I'm not afraid of Dalton, Hank."

She could hear a long, drawn-out sigh of resignation on the other end
of the line.  "Okay.  I'll warn him.  And I'll tell him you told me."

Anne sensed Ajemian's despair.  She didn't share it.  "Things will work
out, Hank."

"I don't see how, Anne.  Jesus, I really don't see how."  Ajemian hung
up.

Anne turned off the computer and the desk lamp and went to the
window.

She opened the drapes and looked out.  The first glimmers of dawn had
settled a dim red glow on the tops of the roofs across the street.

Below, the rows of neatly fenced backyards were still sunk in a pale,
ghostly gray.  No one was abroad.  The back windows of the brownstones
across the way on Perry Street were all dark.

Except for one.  On the top floor of the building directly opposite
hers a shade on one window was raised partway up and the room inside
was illuminated by a bright light.  She had thought the apartment
behind that window to be unoccupied.

She could see three men.  They were standing around, talking casually,
as if taking a break from their work.  One was darkhaired and muscular,
another red-headed and slight.  The third man, older and taller than
the other two, had a peculiar-looking long face, with big ears and
close-set eyes.  His hair was snow white and his skin dark black.  She
thought that she had seen him somewhere once before, a long time ago.

Mounted on tripods and clearly visible just inside the window were two
large pairs of binoculars.  Their lenses were pointed directly at
her.

One pair appeared to have a camera attached to its back end.  On a
third tripod just behind the binoculars was what looked like a small TV
satellite dish.  That was also pointed directly at her.

The call came in the middle of the night.  Dr. Laura Garhardt groped
in the dark for the telephone receiver and tried to clear the sleep
from her throat.  "Yes?"

"Doctor.  It's Franz Hartmann, at the clinic."

"Yes, Franz."

"One of our women in the pilot program was just brought in, about
fifteen minutes ago."

"Who?"

"Nadja Georgiescu."

Garhardt sensed the anxiety in Hartmann's voice.  "What's the
matter?"

"She .  . . We delivered her baby."

"So soon?"

"It was stillborn."

Dr.  Garhardt pressed a hand over her eyes.  "What was wrong?"

Hartmann didn't answer immediately.  Garhardt repeated the question.

"We don't know," he said.  "You'd better come down."

Garhardt threw on some clothes and hurried through the long, deserted
corridors of the palace.  Rather than wait for an elevator, she ran
down the four flights of stairs and across the building's main lobby to
the wing in which they had installed the clinic.

Hartmann met her at the door to the delivery area.  The tall young
doctor's face was grim.

345

"How is she?"  Garhardt asked.

"Nadja?  She's all right.  We gave her a tranquilizer and put her to
bed."  Hartmann ushered Dr. Garhardt into a small laboratory down the
hall from the OR and the delivery rooms.

"Over here," Hartmann said, pointing toward the counter along the far
wall.  A bundled-up white cotton blanket lay on the black Formica
surface.  Large areas of it were covered with a mysterious dark brown
stain.

Hartmann pulled the cloth aside to reveal the dead infant.  Garhardt
uttered an involuntary gasp, closed her eyes, then opened them and
stared at the nine-pound baby boy lying inert and lifeless on its back,
its eyes closed, its head turned to the side.  One arm was stretched
out, the fingers extended from its tiny hand, as if it had reached out
to clutch at something during its last moments.  Garhardt gently pushed
the arm down against its side.

"I drew a blood sample," Hartmann said.  He tilted his head in the
direction of the lab bench across the room, where two technicians, also
just roused from sleep, were beginning work preparing the sample for
tests.

Garhardt just nodded.  The infant looked entirely normal.

Except for the color of its skin.  It was a dark shade of blue.

Garhardt had a terrible premonition.  She touched a patch of the
chocolate-brown stain on the blanket.  "Is this its blood?"  she
asked.

Hartmann nodded.

"Hemoglobin M," she muttered.

Hartmann didn't reply.  He was watching her nervously, waiting for her
to tell him what she wanted him to do.

"Take a mucus sample for DNA testing," Garhardt said.  "I need
chromosome 11.  Isolate and sequence the beta globin and the epsilon
globin genes.  As soon as possible."

"Okay."

"And get all the other women in the program in here immediately.  Start
calling them right now.  I want blood and tissue samples taken from all
the fetuses this morning.  Run the same tests on the globin genes.  Get
the whole staff up.  We need the results today.  And keep the women
here."

J U p I e r s LJ a u g n l e r Hartmann went off to find the list of
phone numbers for the other twenty-three women.  He shouted at somebody
to wake the second ambulance crew.

Garhardt took one last look at the inert form of the infant on the lab
bench and then gently pulled the cotton blanket over it and went to her
office to wait for the results of the testing.

The hours passed with a glacial slowness.  Garhardt drank cup after cup
of black coffee and alternately paced her office and stood by her
windows, staring out at the snow-covered peaks of the Carpathian
Mountains to the north.  She filled a hypodermic syringe with a
powerful tranquilizer and injected it into her forearm.  It failed to
still the panicky tumult boiling in her chest.

All during the early hours of the morning the pregnant Romanian women
were brought in, undressed, and put to bed.  Long needles probed into
their uteruses and through the amniotic sacs to extract a few drops of
blood and a few cells of tissue from the still-living embryos inside.

The blood and tissue samples were swiftly processed and analyzed.

It was late at night before the results were complete.  They confirmed
Garhardt's worst fears.  The fetuses of all twenty-four of the women in
the test program had the same problem--an error in the genetic coding
of the epsilon globin genes, causing them to produce a defective
hemoglobin called hemoglobin M.

This same error sometimes occurred in natural circumstances, usually on
a beta globin gene.  Those who suffered from it had blue skin and blood
the color of chocolate.  Ordinarily they survived, because the mutation
appeared in only one of the two copies of chromosome 11 that everyone
was born with.  But the tests of the twenty-four fetuses in Doctor
Garhardt's program all showed the identical flaw occurring on both
copies of chromosome 11.  The coding error was incredibly minute--one
incorrect nucleotide sequence out of three billion.  And it was
absolutely fatal.  Every single one of the fetuses would either be
stillborn or die shortly after birth.  Nothing could save them.  They
were the victims of a design flaw.

If she had been allowed the time and expense to subject Jupiter's
blueprints to the kinds of preliminary screening tests she had
requested, all this might have been avoided, she thought.

Might have been avoided.

She would have checked Jupiter's beta globin sequences for the kind of
coding error that would produce hemoglobin M, but she might well have
overlooked epsilon entirely.  The epsilon globin gene functioned only
during the first few weeks of an infants existence.  Then it shut down
entirely, leaving the task of hemoglobin production to the other globin
genes, primarily beta.

The error was not an accident, Garhardt realized.  The odds of
forty-eight parents having identical flaws in the epsilon globin genes
of their germ cells were so astronomically great as to be beyond the
realm of the possible.  The error was obviously in the Jupiter program
itself.  She satisfied herself on this point by running Jupiter through
a new computer trial, using a male and a female genome whose globin
genes were known to be normal.

From them, Jupiter produced a new genome with the same fatal error in
the epsilon globin genes of both chromosome copies.

Sabotage, she thought.

But who had done it?  Some disgruntled scientist here in the labs?  Or
had someone inserted the error earlier, in the original hard-disk copy
of the program, before Garhardt--or even the baroness--had come into
possession of it?  Some employee of Stewart Biotech, in New York,
perhaps?

What other possibilities remained?  Dr. Harold Goth might have made
the mistake himself a long time ago, when he first encoded the program
to a computer disk.  But there was the Stewart daughter, Genevieve.

She had not suffered from hemoglobin M, or, if her tests were to be
believed, any other disorder.

Could the Stewart child be a fraud?  Garhardt had never actually seen
her or tested her herself.

Speculation was useless.  It didn't matter anymore.  It was the
baroness's reaction that would matter.  A preventable mistake had been
allowed to occur.  The test program had been utterly destroyed and the
future of the entire project thrown into doubt.

The baroness would hold Garhardt responsible.  And the baroness was a
vindictive woman.

Garhardt had told the entire staff, except for those monitoring the
pregnant women in the clinic, to get a good night's sleep.  She would
telephone the baroness and relay her instructions to them the first
thing in the morning.

It was now almost midnight, and she had not yet placed that call.  She
could not bring herself to do it.

She sat at her desk through the night, thinking.  Around two o'clock
she had an idea.  She could order C-sections immediately for the
remaining twenty-three women.  If the infants could be transfused daily
for several weeks, until their beta globin genes kicked in to replace
the defective epsilons, they might be saved.

Some of them might be saved, anyway.  Some would still probably be born
dead, before transfusions could even begin.  Maybe all of them would be
born dead.

And what was the point?  The mistake in Jupiter could be corrected and
a second pilot program begun, but for Garhardt herself it was too
late.

The damage was done.  It could not be hidden.

At four o'clock in the morning, groggy from lack of sleep and the heavy
doses of tranquilizer she had been injecting, Laura Garhardt decided
that she had had enough .  . . more than she could bear.

' She mixed a lethal amount of tranquilizer in the hypodermic syringe,
twisted a tube around her forearm to get a good bulge in a vein, and
injected the drug into her bloodstream.

In a matter of minutes the small office around her grew dim and muffled
and began to fade from her sight.  She folded her arms on her desk and
laid her head on top of them.  She felt dreamy-then weightless,
serene.

She drifted into a deep sleep.  From sleep she slipped into a coma.

Dr.  Hartmann found her dead at her desk at eight A.M. o

Dalton Stewart opened his eyes but didn't move.  It was still dark in
the room.  For a few seconds he thought he was in his bedroom on Long
Island.

He stared up into the dark.  His head felt swollen and sore, and he
could hear the blood pulsing in his ears.  He was in the middle of the
worst hangover he could remember.

He felt confused as well.  He squinted at the bedside clock.  It was
just past seven in the morning, and he was still in Munich.

He remembered waking up some time in the middle of the night.  He had a
vague recollection that he had talked with Ajemian.  Ajemian had told
him something about Anne.  He couldn't remember what it was.  Maybe he
had dreamed it.  He pressed his palms against his eyes to shut out the
painful daylight.  No.  It had been something important.

Stewart rose gingerly from his bed and stumbled into the small room
next door that he used as an office.

There was a message on the machine.  He pressed the Play button, then
heard Ajemian's voice:

"Sorry to call in the middle of the night, Dalton, but this is
urgent.

Please call me back as soon as you get this message.  You can reach me
at--" Stewart was shocked to hear his own voice, raw and groggy with
drink, suddenly interrupt: "What the hell you want?"

350

"Sorry, Dalton.  I know it's late--" "What the hell you want?"

"Are you drunk?"

"Probably."

"I located our missing copy of Jupiter.  Anne had it."

Stewart heard himself mumble an indistinct curse.  "You give it to
her?"

"No, I didn't.  She took it herself."

"Not possible."

"Let me tell you what happened.  She broke into your safe and took
it.

She left a blank in its place."

"This a goddamn dream, or what?"

"It happened, Dalton.  And she wanted me to tell you."

"Who did?"

"Anne did.  Dalton, are you listening to me?  She told me Jupiter won't
work the way you're using it."

"How the fuck she know?"

"She's been working on it."

"Bullshit.  I've got to sleep, Hank."

"She says without the right access code--" The conversation ended.  The
answering machine beeped three times and then rewound the tape.

He listened to the taped message again and then dialed Ajemian's home
number in Croton-on-Hudson, New York.  Ajemian answered immediately.

Stewart apologized for the previous conversation.  "I was drunk.  I
thought I was having a bad dream.  What the hell's going on?"

"Anne says Jupiter won't work."

"Yeah.  I already know that."

"You do?"

"The Romanian mothers started giving birth yesterday.  All stillborn.

Every damned fetus.  Something wrong with their blood.

And the doctor there, Laura Garhardt, killed herself.  The baroness is
in a tearing rage.  She's convinced it's sabotage.  Anyway, the
program's a total washout."

"I'm sorry."

Stewart sat down on the edge of the desk.  "Yeah, I know.  You warned
me.  What else did Anne tell you?"

Ajemian described their conversation in detail.  Stewart sat rubbing
his aching forehead with his fingers, trying to organize his
thoughts.

"You've got to get that copy of Jupiter back from her, he said
finally.

"And the access code."

"Not me, Dalton.  This is your business."

"You're right there in New York, for chrissakes.  And she'll listen to
you."

"She's already listened to me.  I asked her for the code.  She
refused.

She doesn't want anyone using Jupiter.  She believes it's dangerous."

Stewart felt a surge of fury.  "She's calling the shots all of a
sudden?"

"She hasn't forgiven you for what you did."

Stewart rubbed the back of his neck.  The hangover fed his anger.  "If
she knows something about Jupiter that I don't, she's going to have to
tell me what it is."

"Don't do anything you'll regret."

Stewart didn't reply.

"And you've got to get the baroness to give us some debt relief,"
Ajemian said.  "Our payments are eating up all our profits.

We'll never get Biotech turned around unless she gives us a better
repayment schedule."

Stewart looked out the window.  A light, misty rain was falling.

"Now's not the best time to negotiate with her.  She's chewing on the
carpets."

"Well, that's the situation.  It's up to you."

Stewart didn't want to wrestle with anything as mentally tiresome as
rescheduling Biotech's debt, or anything to remind him of the
precarious condition of his business empire.  "I'll talk to you about
this later," he said.

"There won't be a later, Dalton.  I'm quitting."

"Don't talk nonsense."

"We're fighting each other, and it's getting worse every day.

The situation here at Biotech's impossible.  The baroness wants to keep
the company on the ropes, and you're not here fighting for it.  I don't
know what the hell you are doing.  But it's not like it used to be
between us.  I owe you a lot, Dalton, but I can't continue in these
circumstances.  I'm getting out now, before things fall apart
completely."

Stewart didn't have the energy to argue with him.  "I'll talk to you
later."

He cradled the phone slowly.  He pressed his fists against his eyes.

Ajemian was an alarmist.  He knew the situation was bad, but things
were not going to fall apart.  He was not going to let them.  Never.

He'd be damned in Hell before he'd repeat his father's disgrace.  He
was going to turn things around.  Starting today.

Starting right now.

He found some painkiller in the bathroom medicine chest, swallowed it,
and forced himself through a long, very hot shower.

By the time he had shaved and dressed himself, it was eightthirty A.M.
He stopped off at a restaurant a block away and took his time eating
breakfast.  After two cups of coffee, his head still pounded, but with
a diminished ferocity.

He returned to his apartment, called the Hauser company receptionist,
told her he wouldn't be in today, and then asked her to put him through
to the baroness.  The baroness was not in.

Stewart reached her at Schloss Vogel.

She was still in a fury from the failure at the Romanian clinic.

She told Stewart that she was firing the entire staff.

"What good will that do?"

"What good?  They were incompetent idiots!"

"They were the best people you could find," Stewart reminded her.  He
relished the opportunity to rub it in.

"It was Garhardt's fault," the baroness fumed.  "The woman was against
the project from the beginning.  She may have sabotaged it."

"You have any evidence?"

"She was in charge.  She had the final approval of all the genome
sequences.  Either she purposely tampered with them or failed to
discover that someone else had tampered with them--" Stewart cut her
off.  "Let me tell you the real reason the project failed.  Because of
you.  You insisted on rushing the project, and this was the result.

Jupiter will function properly only if fed the right access code.  This
was Goth's way of protecting the program from theft."

"How do you come to tell me this now?"

"Because I just found out."

"How is that?"

"I'll explain it later.  First, I have a proposition to make.  I expect
to have the correct access code shortly.  When I have it, we'll set up
a new pilot program.  But this time, I intend to run it.  And I intend
to staff the project exclusively with my people."

"And are you going to pay for it, too, Dalton?"

"No.  You are."

"How do you intend to make that happen?"

"Because you're intelligent enough to see it's the only thing to do.

We both need the program to succeed.  I'm now offering you the only
chance left to rescue the project.  But it'll have to be on my terms
this time, not yours."

The baroness laughed derisively.  "And how do you expect me to accept
such nonsense.  Access codes--mein Gott!  Dalton, you've gone quite
mad."

"Those are the terms.  If you don't like them, I'll develop Jupiter on
my own."  I dj, "So you kept a copy.  You've been planning this all
along."

"No, that's not right.  But Ajemian did find our copy."

"Where?"

"It's not relevant.  I'm going ahead on this.  With your backing or
without it."

"How?  Who'll loan you the money?"

"Take my word for it, Baroness.  I can get it."  ; "Bring me proof that
Jupiter will work your way, and I'll accept ' your terms."

"I thought you might."

Stewart hung up before the baroness had time to say anything further.

For the first time that day he began to feel some optimism.

Jupiter still mattered to her.  That was good.  Because he was going

I

:;

,: 4

I

to do to her exactly what she had been trying to do to him-screw her
out of the deal completely.

And if the baroness tried to get around his terms, that'd be

L okay, too.  He'd cannibalize Stewart Biotech.  He'd sell off enough
pieces of it to finance a couple of years of development.  And the hell
with the rest of the company--there wasn't much left, anyway.  He'd
break it up and let the baroness and the banks fight over the scraps.

He called the airport and booked a flight to New York City.

The men across the way were still watching her.  During the day they
kept the window shade pulled three-quarters of the way down.  Anne
could see nothing through the open space between the shade and the
bottom sill, but she knew that in the darkness on the other side those
huge binoculars and that dish antenna-presumably a listening
device--were trained on her.  At night the shade was often all the way
up, and the room dark.

She had decided they must be Dalton's doing--no doubt with the
baroness's encouragement.  She wondered how long they had been at it.

Days?  Weeks?  What could they have found out?  Could they have seen
her use the Watson access code?

Her computer monitor faced away from the window, so they could not have
read anything off the screen.  Printouts were another matter.  She had
often left them on the top of the small bookcase under the study
window, and she had frequently dumped piles of books and papers on the
chair beside it.  Both areas would be easily visible to those
binoculars.  Had she exposed anything of value?  The more she thought
about it, the more frightened it made her.

She did have one advantage: they didn't know she knew they were
watching her.  She continued to open the drapes at the same time every
morning and close them when she retired at night.

She gathered together all the important material relating to Jupiter,
removed the Jupiter RCD from the computer, and packaged everything in a
cardboard box.  She put the box in a shopping bag

356

and took the material to a bank on Fourteenth Street and locked it in a
safety deposit box.  Knowing that someone might be following her, she
took the bag and the now empty cardboard box back with her to her
apartment.  In the study, she turned on the computer, called up her
word-processing program, and created a document with the title JUPITER
INSTRUCTIONS in boldface across the top.  On the page below, she made
up an elaborate series of steps that one supposedly had to take in
order to make the program work.  When she was finished, she looked at
it and decided that it wouldn't fool anybody.

She finally hit upon something more subtle.  She wrote what appeared to
be a letter addressed to her from a fictitious professor of genetics at
M.I.T. In the letter he referred to his past working relationship with
the late Dr. Goth and explained that in order to make the Jupiter
program function, it was necessary to initiate it with a password.

That password was "Minerva."

She printed the letter out and read it through a few times.  There was
still a problem: the letter wasn't typed on departmental letterhead.

Maybe her fictitious professor wouldn't have used it, but it looked
suspicious; and one telephone call to M.I.T would confirm that he
didn't exist.

Two problems, one solution.  Anne slapped the letter down sideways on
the top of the bookcase, then quickly placed a book across the top of
the sheet, concealing the date, the address, and the missing M.I.T
departmental letterhead.  Just to make sure they got a good photograph,
she turned on her gooseneck desk lamp and directed the light toward the
top of the bookcase.  She left the room that way and went into the
kitchen and had lunch with Genny and Mrs.  Callahan.

After lunch Anne returned to the study with Genny.  She looked at the
letter lying on the top of the bookcase.  Surely the men in the window
across the way had photographed it by now.  She dropped another book
directly on top of the letter and turned off the lamp.

"Will you read me something, Mommy?"

"I will."

Anne read to Genny for about an hour.  Actually Genny did most of the
reading.  She had been able to spell out words since she was two, but
in just the last six months her reading ability had developed
enormously.  She could sound out almost any word in, say, The New York
Times, and she knew the meanings of ninety percent of them.

Of course, many subjects still baffled her, because she couldn't place
them in a meaningful context.

But she was learning fast.  She already knew who the President was, and
she could recite from memory all the states and their capitals, and a
mass of other data she had absorbed from an almanac Mrs. Callahan had
given her.  But at the moment she was entranced by Nancy Drew
mysteries, which were much more fun than the Times.

"Why are you worried, Mommy?"

Anne shrugged and smiled.  "I'm not worried."

Genny laughed.  "Yes, you are too worried.  I can tell."

Anne embraced her.  "How can you tell?"

"I don't know how.  But I can."

"Will you be able to explain it to me someday?"

"I hope so, Mommy."

"Anyway, you're right.  I am a little worried."

"You should go see Auntie Lexy, then.  She always cheers you up."

"Well, as a matter of fact, Lexy and I are going to have dinner
together.  So when Mrs. Callahan comes back with you from the puppet
show this afternoon, I'll be out."

"Can we get a video?"

"Okay.  But just one."

"Can I wait up for you?"

"You better not.  You've been up past ten every night this week."

"But I don't need all that sleep."

"You certainly do need all that sleep."

"No I don't.  Really.  I wake up at night sometimes and stay awake for
a long time."

"You do?  And what do you do during all that time?"

"I like to listen to sounds in the street.  I like to listen to
people.

I can hear them talking.  And I can smell a lot of different things.

Strange, funny things.  It's fun."

"You really should be sleeping.  It's not good for you to stay awake at
night."

Genny scratched her cheek thoughtfully.  "I have something to show you,
Mommy," she said finally.

"Yes?"

"You promise you won't be angry?"

Anne narrowed her eyes, mystified.  Genny had never made such a request
before.  "I can't promise.  But I'll try."

Genny thought about this for a moment, then nodded.  "Okay.

Follow me."  The little girl led her mother to the apartment's front
door.

"It's about Bomber," she said, pointing to the door.  "He's out in the
hall."

Bomber was the upstairs neighbor's pet schnauzer.  He was a minor
nuisance in the building, frequently running loose in the hallways and
barking at all hours.  Twice he had chased Moby Cat, and once caught
him and roughed him up.  Genny disliked the dog intensely.

"Loose again?"

Genny nodded, but she had a peculiar look on her face.  "Go see him,"
she said.

Anne opened the door and looked up and down the hall.  No sign of the
dog.

"He's downstairs, Mommy."

Genny followed her mother down the stairs to the small vestibule just
inside the brownstone's outside door.  She pointed to the floor.  The
dog was lying there, on its side, quite still, its eyes shut.

Anne bent down and gently patted the dog's neck.  It was immediately
apparent that the animal was dead.

Anne rushed upstairs to inform Bomber's owner, a middle-aged woman
named Mrs. Berkin, whom Anne had met only once.  She spent the next
forty-five minutes consoling the distraught woman.

Eventually she helped the woman carry the dog upstairs and called a
veterinarian for advice on disposing of the animal.

Once back in her own apartment, Anne asked Genny how she knew that
something had happened to Bomber.

"He was bad," Genny said.  "He tried to hurt Moby Cat again.

"I know that, darling.  But do you know what happened to Bomber?  Did
you see anyone do anything to the dog?  Or feed him anything?"

Genny shook her head.  She wore an unmistakable look of guilt.

Anne was perplexed.  "You asked me not to be mad at you.  Why should I
be mad at you?"

"It was me, Mommy."

"You?"

"Bomber was bad, Mommy.  He tried to bite me, too."

Anne's puzzlement grew.  "What do you mean?  What did you do?"

"I just .  . . squeezed him."

"Squeezed him?  How?"

Genny put her little hands around her mother's neck to show her.  "I
did it real hard.  Until he stopped moving.  It didn't take long at
all.  He was bad, Mommy.  You know he was bad.  I didn't want to tell
Mrs.  Berkin, but he was a very bad dog."

Anne knelt down and pulled Genny close to her.  Tears welled up.  Dear
God, dear God.

"I'm sorry, Mommy.  Don't cry.  Bomber was bad."

Anne hugged her hard.  My precious child, my precious child.

She felt engulfed by fear.  Thoughts about all those atavistic genes in
Genny's genome swam through her mind.  What was she going to say when
people found out that her daughter was an experiment in human genetic
engineering?

And what was she going to do if something like this happened again?

That evening Lexy and Anne had dinner at a restaurant off Seventh
Avenue.  Anne poured out the whole story about Genny and Bomber.

Lexy made light of it.  "I don't believe it for a minute.  Genny
wouldn't do anything as monstrous as that.  Strangling someone's pet
schnauzer?  Come on!  The child has an overactive imagination.

I know she didn't like the animal.  She probably saw the dog dead and
fantasized that she had killed it.  I'll bet the downstairs neighbor
fed the beast a poison hamburger.  Things like that happen all the
time.  And the dog was a miserable little cur, anyway.  Forget it."

"But Genny's very strong physically.  She could have done it."

"But for godsakes, you'd have heard something, like the dog yowling."

"Oh, God, Lexy, I want to believe you."

"Then believe me.  And have another glass of wine."

Lexy was far more interested in the men staked out in the apartment
facing Anne's study.  She asked a thousand questions, then rendered her
verdict: "I told you.  It's Dalton.  He hired them.  He's trying to
catch you in flagrante delicto, so he can get a better divorce
settlement.  And win custody of Genny."

"I'm not sure he even wants custody."

"Of course he does.  Remember, she's the only proof that Jupiter
works.

Knowing Dalton, he'd probably parade her around Europe with a tin
cup.

Anything to make a buck.  And speaking of flagrante delicto, how about
giving that Dr. What's-His-Name a call?  You desperately need a little
romance in your life."

"I wish you wouldn't keep bringing him up.  I want to for get him."

"You want to forget you made a fool of yourself, that's all."

"That too."

Between them they drank a bottle and a half of wine, and by the time
Anne got back to her apartment on West Eleventh she felt a little
foggy, but much less anxious than earlier in the evening.

Mrs.  Callahan came out to greet her.

"Oh, Mrs.  Callahan, you didn't have to stay up."

"It's okay, Mrs.  Stewart.  I took a nap earlier."

"Did Genny get to bed at a reasonable hour?"

Mrs.  Callahan stared at her with a confused expression.

"What's the matter?"  Anne asked.

"Well, Genny's been gone since seven."

"Gone?  Where's she gone?"

"Well, Mr.  Stewart picked her up."

"What?"

"He said it was all arranged."

Anne's euphoria evaporated.  "Where did he take her?"

"Long Island, I suppose."

"Why didn't you go with her?"

"He told me that you'd agreed it wasn't necessary."

Anne grabbed the phone and dialed the house in Lattingtown.

The phone rang ten times before someone finally picked it up.  It was
the housekeeper, Mrs.  Corley.

"It's Anne Stewart, Mrs.  Corley.  Is my husband there?"

"No, he's not," she snapped.  Since Anne had walked out on Dalton and
was no longer the head of the household, Mrs. Corley saw no reason to
be civil to her.

"Where is he, do you know?"

"I have no idea."

"I'm looking for my daughter, Mrs.  Corley.  Is she there?"

"No."

"Where is she?"

"I have no idea."

"This is serious, Mrs. Corley.  Dalton's taken my daughter without my
permission.  I'm about to call the police and report it."

"I wouldn't bother, Mrs. Stewart.  They left on a plane for Germany
hours ago."

Anne hung up.  "The bastard!"

Mrs. Callahan was standing by the phone, wringing her hands in
anguish.  "I'm sorry, Mrs.  Stewart.  I thought it was arranged.

He said it was all arranged.  I didn't--" "It's not your fault, Mrs.
Callahan.  Go on to bed."

"But I'm very upset...."

"Go on to bed.  I'll talk to Dalton in the morning and we'll straighten
it out."

Mrs.  Callahan went off to her room, sobbing quietly to herself.

Anne sat at the kitchen table, drinking coffee and trying to decide
what to do.  Dalton had obviously planned this carefully.  It would
have taken him time to get Genny a passport, for one thing.  In the
back of her mind, behind the jumble of emotions she was feeling, a
stark terror loomed.  What if he meant to keep Genny?

How was she going to be able to get her back?

By three A.M. Anne felt exhausted.  She went into her bedroom and lay
down.  After a while she drifted into a troubled sleep.

At six A.M. the phone rang.  Anne groped for the receiver.

"I'm in Munich," Dalton told her.  "I have Genny here with me."

"Why are you doing this?"

"I want you back, too."

"You have some way of showing it.  Why did you take her?"

"You know damn well why."

"I don't know damn well why.  But I'm coming to get her."

"Good.  Be on the seven P.M. flight from JFK to Munich tonight.

And bring the copy of Jupiter you stole from me with you.  And the
access code that goes with it.  Otherwise you don't get Genny back.

We'll meet you at the airport."

Anne started to reply, but Dalton had already hung up.

Dalton Stewart and his daughter emerged from his Munich apartment early
in the morning.  While he locked the door, she ran ahead to summon the
elevator.  When the doors opened, she jumped on ahead of her father.

"Which button, Daddy?"

"K-1."

Genny scanned the rows of buttons, found the one labeled K-1, and
pressed it.  "Is that the underground earaee?"

"That's right."

"Is Mommy going to stay with us?"

"I don't think so.  You and Mommy will be going back to New York.

Probably tomorrow."

Genny's eyes watched the flashing numbers on the panel above the door
as they descended the ten floors toward the garage subbasement.  "Do
you love me as much as Mommy does?"

Stewart felt his throat constrict.  "Oh, yes.  Even more."

"Mommy said no one could love me more than she does."

"Well, I guess we're tied, then.  Because no one could love you more
than I do, either."

"Don't you miss Mommy?"

"Yes," he muttered.  He did.

"I miss Mommy already," Genny declared.

"We'll see her soon."

Genny looked thoughtful for a moment.  "I'm glad both you and Mommy
love me, but I wish you still loved each other, too."

364

"I wish we did, too, honey."

"Do you think you will again sometime?"

"Maybe.  I hope so."

The fact that he was using his daughter as a pawn in a power struggle
with Anne and the baroness did not make him feel good about himself.

He knew it would probably end forever any chance of reconciling with
Anne, but he was backed into a corner.  This was his only way out.  If
it worked, everything would become possible again.  And he'd prove to
his daughter just how much he really did love her.  There would be no
end of what he would do for her.  He'd fulfill her grandest dreams, her
most extravagant ambitions.

The elevator stopped and the doors rattled open.

Genny slipped her hand inside her father's and skipped along beside him
toward his car, a gray BMW parked near the back.

"Do you love someone else now, instead of Mommy?"

Her father laughed.  Genny had peppered him with hundreds of questions
ever since he had picked her up in New York.  She would ask three or
four or a dozen completely trivial questions and then suddenly spring a
zinger on him when he least expected it.  "No," he said in a stern
voice, hoping to scare off any further inquiry along this line.

Genny was not deterred.  "Mommy told me you loved the baroness."

He started to say that she was just a business associate, but under the
circumstances it sounded ridiculous.  "No.  I don't love the baroness
at all."

Genny craned her head up to look directly into her father's face.

"Well, I don't even like her at all," she declared in an emphatic
tone.

"No?  Why not?"

"She's bad, that's why."

They arrived at the car.  Stewart unlocked the door on the driver's
side.  Genny was right.  His relationship with the woman was a simple
case of mutual exploitation.  He had lusted after the woman sexually,
but what he had really wanted was her money and her connections.  The
baroness in turn had wanted his empire, Stewart Biotech, to give her a
foothold in the United States market.

And of course both of them had wanted Jupiter.  A couple of predatory
animals, that's what they were, each circling the other and snarling
over who was going to get the spoils of the hunt.

"Mommy has a friend, too.  And I like him a lot."

"Who's that?"

"Dr.  Elder."

"Oh."  Stewart had never heard of him.

"She doesn't see him anymore," Genny said.  "I wish she would,
though.

He taught me lots of neat doctor things.  He showed me how to use a
stethoscope."

Stewart wasn't listening.  He was thinking how Anne still held the key
to everything.  Literally.  God, he hoped she did.  The nightmare
possibility that he was risking so much on the assumption that Anne
knew for certain what she was talking about frightened him.  But if she
did--if the access code really worked--then that was all that he
needed.

And Anne would have to cooperate if she wanted Genny back.

But he hoped, he prayed, he could persuade her to give him Jupiter and
the code willingly.

Genny squeezed past him and crawled across the driver's seat to the
passenger side.  Stewart heard someone calling.  He looked around.

About six cars away, a tall, thin man with a black mustache was
motioning at him and shouting "Bitte!"  in a loud voice.

Stewart hesitated.  The man's attitude annoyed him.  Only in Germany
would somebody shout at you to demand your help.  "I don't speak
German," Stewart shouted back.

"You English?"  the man asked.

"American."

"Good.  You can help me.  I dropped my key.  I can't bend over to pick
it up.  My back is very injured, ja?"

Stewart cursed under his breath.  He ducked down to look at Genny,
squirming around playfully on the leather seat to warm it up.

He felt like a heel not offering to help the man, but there was
something suspicious about him.  He was too young to have a bad
back--and too young to be driving a new, top-of-the-line Mercedes.  The
hell with him.

He started to get into the car.  No sooner had he lifted his foot than
he felt a powerful blow land against the back of his skull.

It hit with such force that he toppled forward and smashed his head
against the car's roof.  Another blow landed behind his ear.

He sagged backwards, unconscious.

A man caught him under the arms, dragged him away from the car, and
dropped him on the garage's concrete floor.  He fished in Stewart's
jacket pocket for a wallet, found one, and opened it.

He grabbed the handful of bills inside and then threw the wallet onto
the floor.

Two other men--the thin one who had called out to Stewart, and a short,
thickset man who had been crouched down out of sight--came running over
from the Mercedes and closed in quickly on the front doors of the
BMW.

Genny reacted instantly.  She fell across the driver's seat, pulled the
door shut, and reached for the button that would lock all four doors
automatically.  The thin one, approaching the driver's side, saw what
she was trying to do and managed to get the door open a split second
before Genny could hit the lever.  He yanked the door wide and grabbed
her arm.

Genny twisted away from him and scrambled into the backseat.

His partner opened the passenger-side front door and leaned in.

"Watch the back door!"  the other one yelled.

Genny had the back door open and was squeezing out.  The heavy one
threw his weight against it, to force Genny back inside.

The thin one opened the other back door and reached across the seat to
grab her.  Genny shoved harder against the door.  The heavy one tried
to hold it but lost ground.  The bottom edge struck him in the shin and
he lost his balance.

His partner grabbed Genny's ankle and pulled her back across the rear
seat.  Genny turned on him and rained a flurry of lightning punches to
his face.  He let go of the ankle to ward off the blows.

In that fraction of a second, Genny jumped out and dashed across the
garage.

They came after her, both yelling at the third man for help.

He looked up, annoyed.  He had explicit instructions to kill Stewart,
and he had been keenly anticipating slamming his blackjack repeatedly
against his head.

But the girl was running straight for him, and running incredibly
fast.

She was not to be hurt, but under the circumstances a quick, hard crack
on her skull was clearly going to be necessary.

When she was almost on top of him, he whipped the blackjack around
violently, aiming for the side of her head.

He missed completely.

Her head plowed into his groin and sent him flying.  The concrete floor
crashed against his back.  He rolled over, gasping for air.

Genny could not find her way out of the garage.  The elevator car had
gone back up, and she couldn't find any stairs.  As a last resort, she
tried to escape up the exit ramp, but the thin man and the thickset one
cut her off and grabbed her, one on each side.

She shook one off, then bit the other's hand.  He bellowed, but held on
long enough for his partner to get a grip on her arm again.

She kicked and thrashed with all her might, whipping her
thirty-five-pound body back and forth, trying to throw them off
balance.

It was all they could do to hold on, but hold on they did.

The third man caught up to them and began slashing at her wildly with
the blackjack.  She dodged several blows and managed to kick him twice
in the legs, but finally he locked an arm around her neck long enough
to smash the blackjack against her head.

With the third blow, she collapsed into unconsciousness.

They carried her to their Mercedes, threw her in the back, and drove
out of the garage, one of the men on either side of her.

They tied her arms together behind her, locked her little ankles in
handcuffs, and stuffed a gag in her mouth.  They weren't taking any
more chances.

Anne Stewart's plane touched down at the Munich airport at ten A.M an
hour behind schedule.  Anne hurried through customs and out into the
arrivals area.  There was no sign of Dalton.

She waited for a few minutes, then called his office number at Hauser
Industries.  The woman who answered told her that he had left word that
he wasn't coming in today, that was all.  Did she care to leave a
message?  Yes, Anne said.  If he called in, tell him she was waiting
for him at the airport.

For the next half-hour Anne paced the terminal, fighting down the
anxiety in her stomach.  Why wasn't he here?

Suddenly she heard herself being paged, in English, over the public
address system.  "Will Mrs. Anne Stewart please report to the
information desk on the mezzanine level?"

Anne hurried up a flight of steps to the mezzanine and looked around
for the information desk.  She spotted it off to the right and started
toward it.

It was a small, circular counter, occupied by a young blonde in a blue
uniform.  Two men were standing next to her.  They appeared to be
waiting for somebody.  One had his elbow on the counter top.  He was
dark and muscular, with sunken eyes, a sharp, protruding Adam's apple,
and a muscle in one cheek that twitched constantly.  Anne had seen him
somewhere before.  She ducked quickly out of sight.

Where had she seen him?  .  . . The night of her dinner for the
baroness on Long Island.  She had gone out to the kitchen to talk to
Amelia.  She'd seen him there, sitting at the kitchen table with the
baroness's chauffeur.  He was a bodyguard.

Were they looking for her?  She decided she had better find out.

She retreated back down to the ground level, changed some American
money for German marks, and found a public phone.  She redialed the
Hauser Industries number in Munich.  The same woman answered.

"This is Mrs.  Stewart again.  I'm still waiting for my husband.

In the meantime, could you please put me through to Baroness von
Hauser?"

"I'm afraid she's not here, either, Mrs.  Stewart."

"Could you tell me where she is?"

"Schloss Vogel.  I'll give you the number."

Anne dialed the new number and was eventually put through to the
baroness.

"Frau Stewart?"

"Yes."

"You've received my message?"  The baroness was trying hard to sound
friendly.

"No," Anne said.

"But you are at the airport, ja?"

"If you have a message for me, please give it to me now."

Hesitation at the other end.  A muffled scratching noise gave Anne the
impression that the baroness had cupped her hand over the phone for a
few seconds to talk to someone else.  "I sent two men to pick you up,"
the baroness said.  "They are at the airport now, looking for you.

They'll bring you to Schloss Vogel."

"I'm not going to Schloss Vogel."

"Of course you are," the baroness replied, her voice unnaturally
cheerful.  "There's nowhere else for you to go."

"Why?  What happened to Dalton?"

"I'm afraid he's had a little accident," the baroness said, in a very
matter-of-fact tone.

Anne clutched the receiver against her neck, too stunned to speak.  She
took a deep breath to compose herself.  "My daughter.

Where is she?  Do you know?"

"Oh, we have your daughter here with us.  And she's fine."

"How did she--?"

"She's just fine," the baroness repeated soothingly.  "She's anxious to
see you, of course."

"Please bring her to the airport.  As soon as you cc "That's not
possible."

"Why not?"

"You know very well why not, Frau Stewart.  I need something from you
first."

"What are you talking about?"

The baroness laughed.  "You really must come to your senses, Frau
Stewart."

"I have the copy of Jupiter with me.  If that's what you want, you can
have it.  That's all I have to give you.  Now you must return my
daughter immediately."

"I want more than that.  I want all the information in your
possession--all of it.  Including, of course, the correct access
code.

I've invested a great amount of effort and money developing Jupiter.

I'm entitled to this information."

"You've kidnapped my daughter."

"Sooner or later we'll discover our mistakes anyway, but you can save
us a great amount of time."

"I'll go to the police, then."

The baroness's voice turned threatening.  "Listen to me, Frau
Stewart.

You're being very stupid.  My men will bring you up here and we will
negotiate and reach an agreement.  You and your daughter can be on a
flight back to America by this evening."

Going to the castle was out of the question.  Anne didn't even know for
certain that the woman had Genny in her possession.

"There's nothing to negotiate," Anne answered.  "I'll tell you
everything I know.  I'll give you the damned access code.  I'll give
you everything.  Just please bring Genny to the airport."

"I don't intend to come to the airport.  You must come here."

"First I want to speak to my daughter, to know if she's all right."

"You cannot."

"Please, if you really have her, just bring her to the airport.  I'll
give you everything I have.  Please!  Why can't you do that?"

The baroness raised her voice to a shout.  "There is no other way.  Do
you understand me?  If you want to see your daughter alive again, I'd
advise you to get up here as quickly as possible!"

Paul Elder arrived at his office at seven-thirty A.M. to find Carmen,
his nurse, in tears.

The place had been burglarized.  The waiting room and the examination
room were only slightly out of order.  But his small office,
disorganized in the best of times, was an unrecognizable shambles.

Every drawer had been pulled open, every shelf emptied.  The floor was
ankle-deep in paper, books, and medical samples.

The place had been broken into before.  Elder heaved a giant sigh.

"Report it to the police, Carmen.  I'll start cleaning up."

By eight-thirty a semblance of order had been restored, and Elder
started seeing his patients.

The police arrived an hour later.  They asked Elder what had been
taken.  He thought about it, looked around his office, and then decided
that nothing he could think of was missing.  The police went away.

At nine that evening, as Elder was preparing to lock up, he discovered
what was missing: the RCD cartridge in the computer he had borrowed and
not yet returned.  Two spare cartridges were missing as well.  The
significance of the theft dawned on him immediately.  Somebody was
looking for Jupiter.  He no longer had it, of course.  He had returned
it to Anne some time ago.

If there was ever an excuse to call her, this was it.  He grabbed the
phone and dialed her number.  No answer.

He kept trying the number until eleven o'clock.  He knew Anne employed
a live-in nanny.  Why didn't she answer?  Where was everybody?

Elder took a cab to Anne's Village address.  Her name was still on a
mailbox.  He rang her bell.  No answer.

He rang the superintendent's bell.

After a delay, the super appeared at the door.  Yes, she still lived
here, but she was away.  No, he didn't know where she had gone, and it
was none of anyone's business, anyway.

The super started to close the door.

"Wait.  Tell me--was her apartment burglarized recently?"

The super gave him a strange look.  "You police?"

"I'm a friend.  I was a friend...."

"Last night.  The bastards made a mess, too.  There was another lady
staying there--maid or nanny or something.  She moved right out.

Scared the poor woman half to death."

Stewart let the stranger help him up.  He spoke only German, so Stewart
couldn't understand him, but the gist of his questions were obvious.

What had happened?  Did he need help?  Did he want an ambulance or a
doctor?  Stewart kept shaking his head.

He picked up his wallet, lying a few feet from him on the garage floor,
and checked its contents.  The cash was missing, nothing else.

The man helped him to the elevator.  Stewart thanked him and insisted
he was all right.

Back in his apartment, Stewart examined himself.  He had two swollen
bruises on the back of his head.  But aside from the pain, he felt
normal--no memory or vision problems.  He swallowed some painkillers,
then took a cold shower.

There was a Mauser automatic hidden under some socks in the bottom
drawer of his bedroom dresser.  He dug it out, filled the clip from a
box of bullets next to it, and slid it into place in the grip.  He had
acquired the pistol two months ago, on the Romanian black market.  He
had never owned a pistol before, and he had never fired this one.  He
wasn't even sure why he had bought it.

Stewart suddenly missed his chauffeur and bodyguard, Gil Trabert, who
was on an extended vacation in the States.  He could have used him
today.

He put on a lined trench coat and stuffed the pistol in the inside
breast pocket.  It caused the coat to bulge noticeably.  He stuck the
373 box of bullets into a side pocket and went back down to the
garage.

Several minutes later Stewart was out on the autobahn, heading north,
toward Regensburg.  He pushed the accelerator to the floor, and the BMW
screamed down the sparsely traveled highway at 125 miles an hour.

Genny grew tired of crying.  She was still frightened and unhappy, but
crying didn't make her feel any better.  It only made her eyes sore and
her head throb.

She felt the bump over her ear.  It was hot, swollen, and tender.

She looked at her knees.  She had skinned them against the concrete
floor of the garage when the men had dragged her to their car.  She
pressed her hands against them and concentrated on generating some
healing power.  The effort exhausted her after only a few minutes.  And
the knees still felt the same.

She wondered what had happened to Daddy.  Why hadn't he come to get
her?  She hoped he wasn't hurt.

If there hadn't been three of them in that garage, she thought, she
could have gotten away.  Anyway, she was proud of how well she had
fought them off, even if they did finally catch her.

But now that they knew how strong she was, they were treating her with
extreme caution.  As soon as she had come to, some woman had injected
her with a powerful tranquilizer that made her feel very weak and
sleepy.  Two men had then carried her up into the room, removed her
handcuffs, locked the door, and left her.

The effects of the drug were finally wearing off, but Genny worried
that the woman would come back and inject her again.

She walked over to the room's one small window and looked out.  The
ground seemed a long way down.  Even if she could squeeze out the
window, it was much too far to jump.  Beyond the fields around the
castle, she could see only forest.  No other houses anywhere; just very
steep hills and deep woods.

How would Mommy or Daddy ever find her here?

She heard the faint, intermittent hum of highway traffic far away.  She
picked up other sounds--the scurry and cries of animals and insects,
the chirping of a bird, the distant barking of a dog, the subdued clank
of a cowbell.  Several times she caught the shrill voices of children
playing.

The weather was sunny, but a chill March wind was gusting.

There were still patches of unmelted snow in the forest's most shaded
spots.

If she could reach the forest, she thought, she could probably hide
there until she could find somebody's house.  But it would be awfully
cold at night, and they had taken her coat.  And there was a high fence
around the whole place.

She could see big dogs roaming the grounds below.  She didn't like dogs
much anyway, and these looked especially mean.  How was she ever going
to get out of this place?

She thought of her mother again, and tears welled in her eyes and ran
down her cheeks.  Mommy had told her that if anything ever happened to
her she should try to be brave.  She must have meant a time just like
this.  Genny sniffled and brushed her tears away.

If they were going to harm her, they would probably already have done
it, she guessed.  So they must be keeping her here until her mother
comes to get her.  But why was it taking her so long?

She must have landed at the airport hours ago.  Maybe she doesn't know
where this castle is, Genny worried.  It was probably very hard to
find.

Genny went into the bathroom and filled a glass with water.

She brought the glass out and sat down on the bed with it.  She wished
she had some books to read, or at least some pictures to look at.  They
hadn't left anything in the room at all.

She remembered several books of hers that had castles in them.

Some of them looked a lot like this one.  Cinderella was one.

Rumpelstiltskin was another.  And there was one about a girl that was
locked up in a castle, just like her.  What was her name?  Rapunzel.

That was it.  She had long blond hair that she could roll all the way
down the side of the castle tower until it reached the ground.

Genny tugged at her own golden locks.  They barely reached her
shoulders.

In another book she remembered--maybe it was Babar the Elephant--there
was a door right in the floor.  When Babar opened it he found a secret
passage that led right out of the castle.

Genny studied the bare wood floor around her.  There were definitely no
trap doors in it.

She was hungry.  She hoped they didn't forget to bring her some food.

It'd be much harder to be brave if she didn't have anything to eat.

Hours passed and no one came.  Genny skipped around the room and jumped
up and down on the bed for exercise.  She loved to jump on beds, but
her mother was always telling her to stop.

This time there was no one to tell her anything, so she jumped to her
heart's content.  Then she sat on the bed and sang all the songs that
she knew and told herself some stories, pretending that it was her
mother reading them to her.

She frequently went over to look out the window.  The driveway was on
the other side of the castle, so when her mother came up the drive she
wouldn't be able to see her.  But she thought she might be able to
smell her scent as soon as she came inside.

She could detect scent traces of the baroness and the men who had
brought her here.  There were many other odors, but they belonged to
people she had never seen.

As the hours passed, Genny found it getting harder and harder to be
brave.  If her mommy didn't get here pretty soon, she decided, she was
going to have to cry.

The first consular assistant, P. Kenneth Thorpe III, steepled his
eyebrows together in an expression of mild discomfort.  He was young,
plump, and fair-skinned, and he took himself very seriously.  "That's
quite a story, Mrs.  Stewart," he said.  "You'll have to admit."

Anne was sitting in the small hard-backed chair facing Thorpe's highly
polished antique desk.  "Is that all you can say?"

Assistant Consul Thorpe leaned back in his chair and wiggled his gold
pen nervously between his thumb and forefinger.  His pale blue eyes
glanced around the room, as if he wished there were someone else
present he could talk to, instead of Anne.  "What do you expect me to
say?"

Anne could barely conceal her fury.  "That you're going to do
everything possible to find my daughter.  And that you're going to
start doing it right now."

The assistant consul sighed, rode his chair back up to a level
position, and glanced down at the notes he had taken.

"Are you aware, Mrs. Stewart, that the Baroness von Hauser happens to
be one of Munich's--indeed, one of Germany's-most prominent
citizens?"

"She has my daughter!"  Anne shouted.  "I don't care how damned
prominent she is.  She's kidnapped her!"

Thorpe cleared his throat.  "Yes.  So you've told me.  I might point
out to you as well that the baroness is also extremely wealthy.  She
really has no conceivable reason to kidnap anyone."

"I've explained to you what she wants.  She wants information from me
in return for my daughter."

"Why don't you just give her this information, then?"

"I offered to.  But she refused."

"But why would she do that?"

Anne clenched her fists.  "I've told you.  She's trying to develop and
exploit a genetic formula that originally belonged to my husband.  The
formula was used on my daughter.... Look, this is hopeless.  You won't
believe anything I tell you.  I want to talk to someone else."

Thorpe arched an eyebrow in disapproval.  He didn't appreciate this
attempt to go over his head.  "There is no one else here in a position
to help you, Mrs.  Stewart."

"Then call the police!"  Anne cried.  "If they go up there they'll find
my daughter!"

Thorpe glanced anxiously toward the door, apparently afraid that Anne's
yelling might be overheard.  "The police have to have a very plausible
reason for doing such a thing, Mrs. Stewart," he replied.  "Search
warrants are required in Germany, too, you know.  Just like the United
States.  And for good reason.  As you can imagine, Baroness von Hauser
would not be very pleased to have her premises searched unless there
was a very wellestablished reason for doing so."

Anne stood up.  "You won't do anything?"

Thorpe motioned to her to sit down.  She remained standing.

"I can see that you're upset," he said in a placating tone.  "And
that's understandable, of course--if what you say is true.  But Mrs.
Stewart, you must be patient.  Of course I'll do all I can.  As soon as
we can get a confirmation of your alleged missing husband, we'll take
matters from there.  We'll investigate.  We'll contact the appropriate
authorities.  If your daughter is truly missing, then I'm sure she'll
show up soon.  It seems to me highly likely that she's still with her
father.  If she doesn't show up soon, we'll urge upon the appropriate
authorities that they redouble their efforts.  In the meantime, you
really need not worry unduly.  Munich is a very safe city.  There's not
nywhere near the crime here that you'd find in New York or Chicago or
Los Angeles.  Far from it.

The Germans are a very law-abiding people--" "And you're a jerk, Mr.
Thorpe," Anne cut in angrily.  "A stuffy, conceited little jerk.  If
anything happens to my daughter, I'll hold you personally
responsible."

"Now really, Mrs. Stewart.  I can see that you're very upset, but--"
Anne stormed out, slamming the ten-foot-high oak door to his office so
hard it shook the paintings on the wall and rattled the tray stacked
with empty coffee cups and saucers sitting on his secretary's desk.

Out on the street once more, Anne glanced around her, not really seeing
anything.  She felt panicked and helpless.  What was she going to do?

Dalton Stewart raced northward in the BMW, his mind churning.

He tried to order his thoughts calmly, rationally.  He had to get Genny
back.  Nothing else mattered.

He looked down the highway.  A big trailer truck had moved out into the
passing lane and pulled abreast of the car in front of it.  Now it was
moving along beside the car.  At 125 mph, Stewart was rapidly closing
in on the truck.  He slowed and flashed the high beams of his
headlights several times, to no avail.  He slowed further and hit the
horn with his fist.  The truck, now only a few hundred feet in front of
him, still refused to move out of the left lane.  It continued to stay
precisely abreast of the sedan in the right lane.  Stewart looked at
the speedometer: his speed had fallen to about 85 mph.

Stewart swung into the right lane and flashed at the automobile, a
black Audi.  The Audi also ignored him.  He swung back into the left
lane and looked in the rearview mirror.  Another truck-also a semi--was
coming up in the right lane.  A third truck moved out from behind that
one to pass it.

In a few seconds the two trucks behind him had closed the gap.

The one in the right lane was now traveling alongside him.  The other
one was directly in back of him, practically riding on his tail.

The truck behind kept closing in.  All he could see in his rearview
mirror was the massive steel grille of the vehicle's radiator.

He accelerated until he was a car length from the back bumper of the
truck ahead of him.  The truck behind closed right in on him, moving up
just inches from his bumper.  The rear end of the truck in front was
now hanging right over his hood.  On his right, the third truck
presented a solid wall of white corrugated steel.

Four huge tires on the twin rear axles were rolling furiously along the
roadway three or four feet from the side of his car.  On his left, the
median divider pitched down sharply and then up again at an even
steeper angle, to meet the lanes on the other side.

The truck behind nudged his tail.  The BMW bounded forward and bounced
against the front truck's bumper.

Stewart's hands squeezed the steering wheel.  His foot was frozen in
place on the gas pedal.  There was no room to maneuver.

Even the slightest change in speed would bring disaster.

But if he did nothing, they'd crush him.

"Hello?  Alexandra Tate?"

"Yes."

"I'm sorry to bother you.  My name is Paul Elder.  I understand that
you're a close friend of Anne Stewart's."

"Yes, I am."

"Well, this is a little embarrassing, I'm afraid--" "Oh, don't worry.

I love to hear embarrassing stuff."

"Well, I'm worried about Anne.  I have no right to be worried about
her, but I am...."

Bored and anxious, Genny prowled around the small bedroom and bath that
made up her prison.  She found an old-fashioned men's razor on top of
the medicine chest in the bathroom.  It had been there a long time, and
the blade had rusted away.

Genny pushed the bed a couple of feet to the side and crouched down
beside it.  The ancient floor showed signs of dry rot.  Near the wall,
one of the bed's iron legs had, over time, worn a substantial
depression in one of the boards.  Using the flat corner of the razor to
saw away part of the edge of the board, Genny was able to get
underneath with her fingers and pry up a six-inch-long fragment of one
plank.  It immediately disintegrated into dusty, flaking pieces.

Genny had expected that as soon as the floor plank had come loose, she
would be able to look right down to the floor below.

She was disappointed to discover that beneath that board was another
one.

She jammed the handle end of the razor down into the wood of the
subfloor.  It was punky and soft.  Soon she was able to punch the
handle completely through.

For half an hour she worked furiously, pulling up more pieces of rotted
floor planking until she had removed a ragged, roughly rectangular
section about a foot wide and a foot and a half long.

That left the subfloor.  The entire surface that she had exposed felt
rotted and soft, but the wood was thicker than the floor planks, and
she couldn't get her finger around the edges to pry up on them.

She stood up and jumped on the spot.  It sagged, but nothing gave
way.

She jumped half a dozen times, but the subfloor held.

She stopped and listened.  She was afraid someone might have heard her
jumping.  After a few minutes, she decided that no one was coming to
investigate.

She moved the bed so that one side of it lined up with the edge of the
rectangle of exposed subflooring, then climbed up on the mattress.  She
focused on the spot, twenty inches below her feet, took a big breath,
and jumped.

Both heels struck the spot together.  The wood gave way with a
splintering crack, and Genny disappeared through the floor.

Anne spent most of the afternoon at a Munich police station.

At first everyone appeared eager to help.  But there was a language
problem.  The only individual who spoke English was a middle-aged desk
sergeant.  He ushered her into his cubicle of an office, ordered her
some coffee, and listened attentively, staring alternately at her face
and the front of her blouse, as she poured out her story.

When she finished, she discovered that the man's understanding of what
she had just told him was hopelessly garbled.  He seemed to think that
her husband and the Baroness von Hauser had run off together and taken
Genny with them in some kind of transatlantic custody battle.  Anne
tried repeatedly to explain, but the sergeant, whose name was Ottmar
Klempe, just couldn't seem to get it straight.  And he was becoming
angry and impatient with her, because he thought she was questioning
his ability to understand English.

When he began to perceive that she was accusing the Baroness von Hauser
of kidnapping her child, he wagged an admonishing finger at her.  He
leaned forward across his narrow metal desk and addressed her in an
ominous tone.  "Der Baroness iss fery powerful.  Fery, fery powerful.

You should not say about her such sings."

Anne walked out of Klempe's cubbyhole and returned to the front desk.

She demanded to see the chief of the Munich Police Department, or
whoever was in overall authority.

382

l, Heidi, the young woman at the front desk, was no longer eager to
help.  She was annoyed that Anne couldn't speak German.  She also
didn't like her persistence.  She demanded to see Anne's pass port
again, and this time she held on to it.

Klempe, meanwhile, had emerged from his cubicle and was regaling
everyone behind the waist-high, glass-topped barricade that separated
the department's working area from the public lobby with his version of
Anne's story.  Several employees began making loud comments; others
stared at her.  Anne understood very little, but it was obvious that
they were discussing the merits of her charges.

She sat on one of the red-and-blue plastic chairs arranged along the
wall, determined to stay until someone agreed to do something.  Ten
minutes later, Klempe, in an almost comically officious tone, relayed
the news to her that the chief would indeed see her, but she might have
to wait.  He was very busy.

She said she'd wait.

The attention of the station switched away from her as completely as if
she had walked out the door.  She was a problem, and someone higher up
had just taken her off their hands.

Anne sat on the hard red plastic chair for over an hour, watching the
riffraff of the Munich streets--prostitutes, pimps, pushers, and an
occasional drunk-and-disorderly--parade past her on the way to an
arraignment or a lockup.  Lawyers and family and friends of the
arrested filled the chairs around her, smoking and talking in voices
amplified by the tile walls around them.

The frustration of not being able to communicate added greatly to
Anne's panic.  She feared that she would just go berserk and start
screaming at people if the chief didn't send for her soon.

At five P.M. a woman in civilian clothes came to the gate in the
barrier and called out Anne's name.  Anne jumped up and ran over, tears
of relief in her eyes.

"I'm sorry to keep you waiting so long," the woman said in almost
accentless English.  "The chief has been very busy.  My name is Marthe,
by the way."

Anne shook the woman's hand.  "I'm so glad you speak English.

I've felt so lost and alone ever since this happened."

"I understand very well.  I'm sorry."  She escorted Anne down along a
corridor to the back of the building, and then into an elevator.  She
pressed the button for the top floor.

"Does the chief--what is his name?"

"Werner Schmidt.  Chief Werner Schmidt."

"Does Chief Schmidt speak English?"

"Yes, he does.  Better even than me."

"Thank God for that."

From the elevator bank on the top floor, Martha ushered Anne down
another long corridor.  This one had plush carpeting, and the noise
level was far quieter than below.

Marthe showed her into the chief's office and settled her in a seat
next to a big, dark wooden desk.  There she waited another ten minutes
before Chief Schmidt appeared.  He was a tall man with dark hair, a
walrus mustache, and a distinct no-nonsense air about him.

Anne's passport was on his desk.  He picked it up, glanced at it, then
handed it to her.

"I am sorry for the long wait, Mrs. Stewart.  Please tell me your
problem."  His voice was neither hostile nor friendly.  It was neutral,
withholding judgment.

"I arrived here this morning from New York.  I was supposed to meet my
husband, Dalton Stewart, at the airport.  He has an office here in
Munich.  My daughter was supposed to be with him.

He never showed up.  I was paged at the airport by Baroness von
Hauser.

I assume you know who she is?"

Schmidt nodded.  He had an elbow up on his desk and was cradling his
head delicately in his hand--thumb under chin, forefinger against
cheek--giving her his full attention.

"She told me that she had my daughter.  How she got her I don't know.

She wants information from me.  I agreed to give it to her if she'd
bring my daughter to me, but she insists I go to her place--a castle
somewhere in the country.  I've never seen it.

I'm afraid to do that.  I don't trust the woman.  I'm at the end of my
rope to know what to do--" Schmidt interrupted.  "Do you know what has
become of your husband ?  " "No.  The baroness said he was in an
accident.  Do you know?"

Schmidt shook his head no.  "Do you have the information the baroness
wanted?"

"Yes."  Anne removed the black plastic RCD from her handbag and handed
it to Schmidt.  She explained what it contained.

Schmidt turned the cartridge over in his hand, then gave it back.

He didn't seem especially interested in it.

"Mrs. Stewart," he said in a low voice.  "Before you came in, I took
it upon myself to telephone the baroness, so that I would be better
prepared to talk to you.  Would you like to hear what she told me?"

Anne met the chief's dispassionate gaze with a look of surprise.

"Of course."

"Very well."  Schmidt pulled a small notebook from his pocket, opened
it, glanced at a page, and looked up at Anne.  "She did indeed admit to
me that she has your daughter--Genny, is that her name?--yes.  She has
Genny with her.  She explained to me that the girl was brought to her
estate--Schloss Vogel--by her father, yesterday.  He left Schloss Vogel
this morning to pick you up at the airport and bring you back to the
estate.  When it was apparent that he had not arrived to pick you up,
the baroness called the airport and had you paged.  When you called
her, she told you that Genny was safe with her, but that she didn't
know what had become of your husband.  She offered to send someone to
the airport to pick you up, but you refused.  Instead you insisted that
she bring a large sum of money to the airport before you would give her
this computer cartridge.  The cartridge, as she explained it to me, is
the property of a joint venture between her and your husband.  You're
now separated from your husband?"

"Yes, but--" "The baroness told me that you stole this cartridge from
your husband's office in New York, because you knew it was valuable,
and wished to force your estranged husband and the baroness to pay a
ransom for its return.  She said your motive for this was twofold:
first, to get money, of course; second, to get revenge on both her and
your husband.

The baroness and Mr. Stewart are to be married, as I understand it,
pending his divorce from you.

And she did also warn me that you might claim that she was kidnapping
your daughter.  If you want your daughter, she informed me, all you
have to do is go to Schloss Vogel, give the baroness the cartridge, and
pick up your child."

The chief tucked the notebook back in his suit pocket and smiled
patronizingly at Anne.  "Now, doesn't it sound to you, Mrs. Stewart,
that what the baroness told me is probably the truth ?  " Anne just
stared at the man.  She could no longer summon the kind of outraged
anger she had unleashed against the official at the American embassy.

She felt truly alone and abandoned.

For an instant Stewart was tempted to do nothing, to accept the fate
offered him.  Let the damned murder run its course.  Solve all his
problems.  Foot steady on the gas pedal, holding the speed at 85 mph;
hand steady on the wheel, straight ahead.  Do nothing, and let it all
come to an end in the next few seconds.

But he had to get his daughter back.

The thought of Genny made him want to weep.  He was so proud of that
child.  So intensely proud.  And he had never really been proud of
anything before.

Genny was valuable beyond all the money in the world.  She was a new
kind of human.  Homo sapiens rex--smarter, stronger, and healthier than
anything the world had ever seen.  No one yet knew her potential.  But
what was truly important was that she was his child, his only child.

He'd get her back.  Whatever he had to do, he'd get her back.  Nothing
would stop him.

He sensed the roadway curving slightly to the right.  The back end of
the truck in front was no longer parallel to his windshield, but
bending slightly, opening a few more inches of room on his left side.

It had to be now, before they were through the turn.

He cranked the wheel sharply left.

The BMW lurched out of its three-walled moving prison with a
high-pitched squeal of tires and plunged down the bank of the median
divider.

Stewart straightened the steering wheel instantly and began applying
the brakes.  The surface was rough grass, and the car bucked furiously
as it shot diagonally down toward a concrete drainage ditch at the
bottom of the divider.

The left front tire slammed into the ditch.  The car swerved, throwing
the back left tire into the ditch as well.

Trapped in the concrete channel, the BMW continued forward, tilted over
at a forty-five-degree angle.  The car's undercarriage scraped along
the near edge of the ditch with a shower of sparks and a shriek of
tearing metal.

Directly ahead the ditch terminated in a concrete catch basin.

Stewart clutched the wheel and hit the brake pedal with all his
strength.  The pedal slammed against the floorboard with no
resistance.

The brake lines were severed.

Stewart yanked the emergency brake.  The BMW's momentum slowed.

Stewart pulled harder.  The emergency brake line parted and the handle7
its purchase lost, flew backwards in his hand.

Stewart jammed the shift lever into first gear.  The car's momentum
slowed further, but not enough to stop short of the catch basin.  The
left front edge of the bumper hit the concrete first and crushed
against the left front tire.  The bottom of the radiator struck next,
and the car's front end, designed to give way under high impact,
collapsed back against the reinforced frame of the passenger
compartment.

Amidst the buckling and rending of metal and a rain of thousands of
pellets of safety glass, the BMW came at last to a halt, tilted steeply
on its left side.

The safety bag deployed, slapping back hard against Stewart's face and
chest, and then deflated.  Black smoke billowed from the accordioned
remains of the engine compartment.

Stewart was shaken up but conscious.  He pulled on the door handle.

The catch released, but the door wouldn't open; it was wedged against
the concrete side of the drainage ditch.  He pressed the button to open
the window, but the window didn't move.  He tried the other windows.

None worked.

He grabbed the hand hold over the passenger-side door and pulled
himself across the front seat.  He braced his feet against the drivers
side door and pulled on the passenger side door latch.

The latch clicked open.  He pushed the door outward, but it was tilted
up at such a sharp angle it refused to stay open.  He braced one foot
on the side of the driver's headrest and pushed himself about a foot
closer to the passenger door, but he still couldn't hold the door open
and climb out at the same time.

Stewart could now smell gasoline mixed with the acidic, choking stench
of the black smoke.

Genny pulled herself up to her hands and knees and looked around.  She
had landed on her feet and then fallen forward and banged her head and
the heels of her palms.  She felt dazed, but after she stood up her
head cleared and she knew she wasn't badly hurt.

It was quite dark.  What light there was seemed to come from far
above.

She looked up and saw the small hole in the floor she had fallen
through.  It was far out of her reach.

Gradually her eyes adjusted to the dim light.  She turned around,
trying to determine where she was.  There were walls on either side of
her.  They were so close that she could touch them with her elbows.

She was in a narrow passageway.  The floor was wood and the walls were
stone.  Down one way it was pitch-black, but in the opposite direction
she could detect a faint amount of light.  She decided to go that
way.

Keeping one hand on the wall to guide her, she started off, placing
each foot carefully ahead of her, inches at a time.  The old plank
flooring creaked, and her feet crunched on occasional pieces of stone
and cement that had fallen from the walls over the years.

The air in the passageway was stale and chilly; it irritated her lungs
when she inhaled.  Thick cobwebs brushed against her face.

She stuck her free hand out in front of her to ward them off.

Layer after layer of intricate olfactory sensations swarmed through her
nostrils, forming a complex tapestry of ancient smells, from the
pungent bittersweet of decomposing wood and insect and rodent remains
to the dusty, astringent sting of the masonry.  It reminded her of the
musty, dirt-floored cellar under the old stable at the house on Long
Island.

The light became a little brighter.  She could see a dimly glowing area
in the distance.  She increased her pace, taking full steps.

The dim light was coming from a tiny hole in the wall, too high up for
Genny to look through.  She put her hand against the wall, then braced
her feet against the opposite wall and walked her way up the stone
until she could put her eye to the opening.  She saw part of a
bedroom.

There was a double bed with a canopy over it, and a big, round,
windowed alcove with melon-colored drapes.  A polished antique desk and
chair were positioned on a small oriental rug in the center of the
alcove.  The floor, decorated in an elaborate parquet design, gleamed
warmly in the lateafternoon sunlight.  Clothes were thrown on the bed,
along with some funny-looking black and red underwear.

Genny listened for sounds.  No one seemed to be in the room.

She put her nose to the peephole and sniffed.  Cigarette smoke.  It was
from a different kind of cigarette--not the kind the people from home
usually smoked.  She could also smell several kinds of soaps, colognes,
bath oils, and shampoos.  And some kind of alcoholic drink.  She could
catch subtle traces of a woman's odor.

Not the baroness's, though--Genny would recognize her smell
immediately.

Genny dropped back to the floor, then reached up and probed the edge of
the hole with her fingers.  She felt a round metal plate on a pivot
that could be swung down to cover the opening.  She moved it back and
forth a couple of times, then left it as she had found it.  The part of
the wall around the hole seemed to be wood.

Genny continued down the passage.  Six feet further along she ran smack
into a wall.  When she had recovered from her surprise, she felt around
with her hands and feet and discovered that the passage continued to
the left.  It was utterly black.  Even with her extraordinary eyesight,
she could see nothing.  She moved her hands carefully along the wall
surface.  The stones were rough and irregular, and she had to proceed
slowly.  She listened for sounds.

Someone was walking along the other side of the wall on her left.

She heard a door open and close nearby.

Her fingers made contact with more wood.  She reached up and felt
another small metal disk like the first one.  She slid it back and
forth but saw no light.  There was probably a room on the other side
here too, she decided, but something must be blocking the view.  A door
opened and closed somewhere nearby, and she could hear, further away,
the soft murmur of women's voices, talking in German.

There must be a door somewhere, she thought, because she could smell
the odors left by people who had been in the passageway recently.  If
only she had a flashlight.

Genny yawned.  It was her nap time.  She was also thirsty and had to go
to the potty.  She thought she should probably turn around and go back
to her room.  Later, she could explore further.

Then she remembered the hole she had fallen through.  It was so high
up.  How was she ever going to climb back through it?

Genny pressed her hands against the walls and moved forward
cautiously.

She heard a muffled scurrying close by, then some high-pitched
squeaks.

Mice.  She wished she could see them.  There must be a lot of them
around, because she could smell their urine everywhere, as well as the
peculiarly delicate musty scent of their fur.

Genny felt a slight current of air moving against her face.

Where was it coming from?  she wondered.

She took another step forward and fell through the dark.

Dalton Stewart crouched with his feet braced against the driver'sside
door, and pushed up against the passenger-side door with his head and
both hands.  The smoke was choking him and his eyes were swimming.  He
pushed until he was standing erect, his head and shoulders out the
doorway, still bearing the weight of the door.  He brought one foot up
onto the passenger-side headrest, then heaved himself up again.

He finally crawled out, bearing the weight of the door all the way.  He
flung his feet free and rolled onto the ground, letting the door slam
closed again.

He coughed and rubbed his burning eyes.  The smell of gasoline made his
nose sting.  The gas tank under the rear trunk had ripped open and fuel
was pouring out of it, flowing down the concrete ditch toward the
smoking engine compartment.

Stewart staggered to his feet, patted the breast pocket of his trench
coat, felt the pistol, and started climbing back up the grassy bank
toward the roadway.

He reached the shoulder of the highway and turned around just in time
to see the BMW engulfed in flames.  He felt both dazed and exhilarated:
nothing like a narrow escape to make one feel lucky.

Stewart brushed himself off, waited for a break in the traffic, then
crossed the roadway to the right side and started walking.

Cars had slowed to watch the fire, and someone pulled over to offer him
a ride almost immediately.  He was an old man driving a beat-up Opel
Kadet.  He spoke almost no English, and Stewart was grateful for
that.

Stewart managed to communicate to him that he wanted to go to
Regensburg.  The old man muttered some objections.  Stewart got the
impression that he thought he should get off at the next exit and
report the accident.  Stewart insisted on Regensburg.  The old man
ignored him.  He took the next exit off the autobahn and deposited
Stewart squarely in front of the police station in the tiny village of
Geisenfeld.

Stewart stood on the sidewalk until the old man's Opel had disappeared
around the corner, and then went in search of a car rental agency.

There was none in the town.  Stewart ended up paying an exorbitant
price with a credit card to "rent" a very used Volkswagen sedan from
the owner of an auto repair shop.

Stewart drove north to Neustadt and Abensberg on Route 300 as fast as
the narrow, winding road would permit, then took Route 16 to
Regensburg.  He wondered if the men in the trucks were still looking
for him.  He knew it was unlikely they would spot him in this car; but
every time he encountered a large semi on the highway, he felt his
chest tighten.

In Regensburg, he wound through the narrow medieval streets of the city
center and turned into the Haidplatz, the town's oldest square.  He
parked the VW across the square from the entrance of one of
Regensburg's more notorious clubs, a raffish hole-inthe-wall
establishment called the Tischgesprach--German for "table talk."

It was the middle of the afternoon.  Some time in the next seven or
eight hours Katrina would pay her nightly visit to the club.

The club's manager dealt drugs on the side, and Katrina was one of his
regular customers.  She'd stay awhile, have a drink, buy some heroin,
shoot up in the ladies' room, and then go back to the castle.  Stewart
knew her routine because he had accompanied her on several occasions.

He had even tried the heroin.

He sat back to wait for her.

Genny sat up and felt around carefully in the dark.  She had tumbled
down a steep, narrow flight of stairs.  Her head hurt, and so did one
of her arms.  Fortunately, the steps and the floor she ended up on were
made of wood, not stone.  She guessed she was okay.

She crouched forward, feeling the way with her hands, and began to
explore the passage on this level.  Barely three steps from the stairs
she felt the way blocked by a solid wall.  She felt around, but there
was no question that it was a dead end.

She groped her way back to the stairs and stood there, listening.

She could still hear the squeaking of mice.  And the smell of people
was much stronger here than on the floor above.

She worked her way around behind the stairs and discovered that the
passage extended back in that direction.  Feeling her way cautiously,
she walked the full length of it.  It was exactly like the floor
above--a narrow passage that went around a ninety-degree corner.  After
she had advanced about twenty feet past the corner, she got down on her
hands and knees and crawled.  Her bare knees felt very sore.

Her hand soon felt the top edge of another wooden stairway.

She turned around and backed carefully down the steps.  When she
finally reached the bottom, she noticed that the atmosphere was quite
different.  It was damper and warmer, and the odors of laundry soap
mixed with those of wood shavings, paint, and fuel oil.

A few feet from the stairs she saw what looked like four faint lines of
light in the shape of a rectangle.  She stretched a hand out and felt
wood.  A door.  Along one side her fingers encountered three small
hinges.  On the other side she found the door's handle.

She pressed down on it and felt a little click as the latch slipped
free.  She pushed tentatively.  The door moved with a squeak.  She
pushed a little more.  The door opened further but made an even sharper
squeak.  She peeked around the edge.

The door opened into a small closet.  She pushed the door open further,
moving it as slowly as she possibly could to minimize the squeak.  When
it was about a quarter open, she slipped out.  The opposite wall of the
closet contained another door.  She opened it and peeked cautiously
around the corner.

A long, low stone passageway rambled along under a spaghettilike mass
of pipes, conduits, and wires suspended from a series of heavy
archways.  Bare bulbs hung down every thirty feet or so, their low
wattage casting dim, pale yellow pools of light onto the rugged
stone.

She heard the hum of a furnace nearby, and low voices.  The people
smells down here were strong and salty.

Genny tiptoed down the corridor, keeping close to the wall.  She saw an
open doorway on her left and stuck her head around.  Inside was a
low-ceilinged chamber that had been converted into a laundry room.  On
one wall were several washing machines and dryers, and shelves stacked
with linens.  At a big table in the center, a stocky, gray-haired woman
in a blue uniform dress was ironing something.

Next to her another woman was folding sheets and towels.

Genny retreated back to her closet, then explored another arched
passageway on the other side, peeking quickly in the open doorways as
she raced along.  She saw a dark, dirty room with a furnace in it,
another filled with big pumps and tanks, and a third that was a kind of
repair shop.  She darted in and looked around.

Lights were on over a workbench, and her nose told her that someone had
been there as recently as a few minutes ago.  The floor was cluttered
with sections of metal plates.  Someone was repairing a suit of
armor.

Genny glanced over the tools on the workbench.  The height of the
bench's surface just barely allowed her to see over it on her
tiptoes.

To her delight she discovered a flashlight.  She grabbed it and slid
the switch forward.  It worked.

Next to a metal vise she spied a package of cigarettes and a small box
of matches.  She grabbed the matches and tucked them up inside the
cotton sleeve of her blouse.

An old sword was clamped in the vise.  She twisted the vise's handle a
couple of turns and pulled the sword out.  It was about three feet long
and surprisingly heavy.  Her spirits soared.  Now, she thought, let
someone try to catch her....

From the shop Genny wandered past a large area stacked with firewood
for the castle's many fireplaces.  She smelled fresh air.

There must be a door to the outside, she thought, to bring the wood
in.

She started looking for it, then heard steps coming from the other
direction.

She ran back into the repair shop and ducked under the workbench.  The
steps came closer.  From under the bench she could see green trousers
and brown work boots by the doorway.  They paused, then came into the
shop and moved toward the workbench.

She clutched the sword resolutely in her little hands and squeezed as
far into the corner as she could and waited, heart pounding.  The green
trousers took something down from a shelf over the bench, then turned
out the light and left.

When she was sure the way was clear, Genny hurried back to the secret
passageway behind the closet, lugging the cumbersome sword along with
her.  Once inside, she turned on the flashlight and scampered up the
steps.

With the light, she was able to see what had eluded her in the dark.

There were many little peepholes in the walls, all of them covered with
sliding metal discs--and all of them too far over her head for her to
look through.  Around each peephole, she now could see, were small
wooden doors as well, each one cut flush into the stone.  She tugged
tentatively at one, but it appeared to be locked from the other side.

Genny climbed the second flight of stairs and found the spot where she
had fallen through.  She shined the flashlight up at it.

It looked very high.  There were wooden beams overhead that bisected
the passageway at regular intervals, but they were at least eight feet
beyond her reach.

She had to get back through that hole somehow.  The walls of the
passageway were of rough stone and so close together that she thought
she might be able to climb right up them by putting a foot on each
side.

She braced her hands against the walls, placed her sneaker in a little
foothold on the right side, then brought her left foot up and wedged it
in another little depression between the stones on the other wall.  It
was awkward, but if she was careful and took her time, she thought, she
could probably make it.  She jumped back down.

The flashlight was a problem.  She needed it to find footholds and
handholds as she climbed, but she also needed her hands free.

She tried holding it in her mouth, but it was too big.

There was no choice but to try to hold the flashlight in one hand.  It
reduced her ability to brace herself against the wall, but she still
thought she could manage it.

The sword was another matter.  There simply was no way she could carry
it up with her.  Reluctantly, she left it on the floor of the
passageway.

The first few feet up went easily enough, but she couldn't train the
flashlight down enough to find good toeholds in the stone.

She had to feel her way with her feet, and that made the climb slow and
strenuous.  Each upward placement of hand and foot got harder and
harder.  The stone scraped at her wounded knees and made them bloody
again.  The muscles in her legs began to tremble from the exertion, and
her energy started to fade.  Eight feet up, part of the wall crumbled
loose under her left foot and she slipped partway down.  She adjusted
quickly and found new toeholds before she fell.  She gasped, caught her
breath, and looked up.  Not much further.  She gathered her courage and
willpower and started up again, inching along from handhold to
toehold.

Genny's head finally emerged through the hole.  She quickly threw her
arms out across the floor to take her weight.  She let go of her
flashlight, then pushed down against the floor until she had raised her
knees through the hole.

She kicked one leg out, then the other, then rolled onto the floor,
panting for breath.  When she felt strong enough to get up, she pulled
the bed over the hole, hid the flashlight and the small box of matches
under the mattress, and went into the bathroom to wash up and use the
potty.

Anne left the Munich police station in a state of shocked disbelief.

She was trembling from head to foot.  There was nothing left for her to
do but confront the baroness by herself.  She was afraid to do it; the
woman terrified her.  But she'd do whatever she had to do to get Genny
back.  The certain knowledge that she was in the right armed her with
some small courage.

She took a taxi back out to the airport, picked up her luggage, and
rented a car.

She asked an English-speaking woman at the rental counter if she could
provide directions to an estate called Schloss Vogel, somewhere outside
the city of Regensburg.  The woman called her company's rental office
in Regensburg, and someone there knew precisely where the castle was
located.

The woman marked the spot on a road map and handed it to Anne with a
smile.  "They said you can't miss it.  It has four big turrets on the
corners, and it stands on very high ground back off this road.  But .

. ."  The woman paused.

Anne waited.  "But what?"

"Well, they said you won't be able to get very close to it.  The owner
doesn't like visitors.  There are big fences, and dogs to keep people
away."

Anne thanked the woman and tucked the map into her handbag.  "No
problem.  I have a standing invitation from the owner."

The drive took Anne a little over an hour.

By the time she saw the castle, looming to the east over the winding
mountain road just north of the village of Regenstauf, she became
worried that the baroness might not accept the code word "Watson" as
genuine.  Anne had already tried one deception, after all--feeding the
phony word "Minerva" to the men spying on her apartment.  Whose men
were they, anyway?  Dalton's?  The Baroness's?  In any case, she had to
convince the woman that this time she was giving her the real thing.

As well as the Jupiter RCD, she had brought with her copies of three
genomes--Dalton's, Genny's, and her own.  With them, and the use of a
computer, she could feed Dalton's genome and her genome into the
program, run it, and produce an exact copy of Genny's genome.  But
would the baroness accept it?

The driveway leading to the castle was hard to miss.  It was blocked by
a mammoth gate of wrought iron bars and a big sign:

EINTRITT VERBOTEN.

Anne drove the car up to the gate.  TV cameras were mounted on each of
the stone pillars framing the gate.  A harsh, scratchy voice, amplified
by a speaker hidden somewhere around the gate, challenged her: "Was
wunschen Sie?"

Anne swallowed.  "It's Anne Stewart," she replied in a loud, firm
voice.  "I'm here to see the baroness."

"Warten Sie einen Augenbliek, bitte."

Anne shook her head.  "I don't speak German."

There was no answer.  She repeated her request several times but got no
reply.  Minutes passed.  Suddenly the baroness's voice reverberated
through the air.  Her tone was cold.  "Anne Stewart?"

"Yes."

"Have you brought the necessary items?"

"Yes.  I must see my daughter first."

There was a brief pause, then the baroness's voice again:

"Very well.  Drive up to the main entrance.  Do not get out of the car
until the doorman opens your door for you.  If you do, the dogs will
come after you."

The gate rolled open, and Anne drove through.  The bottom part of the
drive wandered through a heavy forest of evergreens.

After several hairpin turns, the forest gave way to a wide apron of
fields and vineyards, and then a series of lawns and formal gardens
that sloped down and away from the castle.

Gigantic and forbidding, Schloss Vogel dominated the landscape.  The
central part of it rose over the high gray-black walls of cut stone
that formed its base like a squat, four-cornered tower.

The narrow windows, deeply recessed in the thick stone, looked like gun
embrasures, and the big, round turrets on each corner reminded Anne of
prison watchtowers.

Then the dogs appeared--at least a dozen.  They bounded rapidly through
the gardens, ran out onto the driveway and fell into place behind the
car.  Anne glanced nervously in her rearview mirror.  They were
following her like a pack of hounds on a trace.

But these weren't foxhounds; they were Dobermans and Alsatians.

There was something distinctly eerie about their behavior.  They
trotted silently along behind the car, as if they were politely
escorting it up to the castle.  Not one of them barked once.  Yet their
silence only magnified their menace.

The drive circled under a large entrance portico at the front of the
castle.  Anne drove underneath and braked to a stop.  Iron portcullises
dropped down over both ends of the portico, shutting the dogs out and
Anne in.

A doorman with a trim mustache came around toward her door.  Anne
grabbed her bag from the passenger seat and let him help her out.

"Guten Tag," he said, with a solemn frown.

Anne nodded curtly, hugging the bag to her side.

A second doorman rushed ahead to open the castle's big double door for
her.  As soon as she was inside, the first doorman grabbed her around
the throat from behind and twisted her arm up behind her back.  The
other one yanked her handbag away from her.

They marched her through several grand salons, past a gigantic
staircase, through the enormous Hall of Knights, all the way to a
service elevator somewhere in the back of the building.  They took her
up two flights, then down a long hallway.  They knocked on a door.

Anne tried to suppress her anxiety and compose herself.

A thickset woman with blond hair braided and coiled around her head
opened the door and let them in.  It was a bedroom.  No one else was
present.

The man holding her let her go; the other one gave her handbag to the
woman.

"Welcome," the woman said, without a trace of irony.  "My name is
Karla.  I am the baroness's personal assistant.  The baroness cannot
see you now.  She asked me to relay these instructions to you, which
she said you would understand.  On that desk by the window you will
find a legal-sized notepad and some pens.

The baroness wishes you to write down for her all the relevant
information you have."

Anne shook her head.  "I want to see my daughter," she demanded.

"Right now."

A look of distress spread across Karla's face.  "The baroness has given
me very explicit instructions," she warned.  "When you have provided
the information she requires, you'll be allowed to see your
daughter."

Her arms folded defiantly across her chest, Anne faced the woman.

"I'll do nothing until I see my daughter.  Tell the baroness that,
please."

Karla ignored Anne's words.  "I will leave you here to write out the
necessary information," she said.  "When you are finished, you may
knock on the door.  Hans and Wolfgang will both be on the other side,
in the hallway.  They will call me and I will take the material to the
baroness immediately."

"Didn't you hear me?  I'll do absolutely nothing until I see my
daughter!  " The assistant hesitated.  She stared at Anne angrily.  She
hadn't expected any resistance.  "Frau Stewart," she replied, in a low,
conspiratorial tone.  "Your daughter is perfectly fine.  I promise
you.

She is upstairs, waiting for you.  Please hurry and give the baroness
the information she needs and I will take you to her."

The woman turned and hurried from the room, taking Anne's handbag with
her.  The two men followed her out.  Anne watched the door slam and
listened to the key rattle in the lock.

The hours passed.  No sign of Katrina.  Maybe she didn't patronize the
Tischgesprach anymore.  She was so mercurial and impulsive that almost
anything could have happened in the last couple of weeks to alter her
routine.

But Stewart was counting on her still needing her daily fix.  He
doubted that she had kicked her drug habit.  So unless she had had a
falling out with the manager, she'd show up.  He would just have to be
patient.

After the sun set it grew cold.  Stewart started the car every halfhour
to let the heater warm up the interior.

The idle waiting left his mind in danger of wandering into treacherous
terrain.  He forced himself not to think beyond the minute.  His plan
would succeed, like all plans, one step at a time.

If he started ruminating about either the past or the future, he knew
he could come unraveled fast.

At 9:30 Katrina's red Mercedes convertible coupe roared into sight,
tires squealing.  She circled the square twice.  Finding no parking
place, she pulled up into the no-parking zone in front of the club's
entrance.

Stewart watched her get out and go into the club.  She was wearing one
of her ankle-length fur coats.  Her unsteady gait suggested that she
was probably drunk.  Stewart climbed out of the VW and hurried across
the square to Katrina's car.  The convertible top was up, but,
typically, she hadn't bothered to lock the doors.  He pulled the
driver's seat forward, squeezed his tall frame into the cramped rear,
and slammed the door.  He crouched down as low as he could manage
behind the front seats, reached into his trench coat's breast pocket,
and fished out the Mauser pistol.

Ten minutes later Katrina came sailing out the door of the club.  The
sides of her unbuttoned fur coat flapped back, revealing black mesh
stockings, a short skirt, and a see-through blouse.  She opened the
door and sank into the driver's seat with a loud, whimpering sigh.

Stewart rose up behind her.

Katrina jerked around and shrieked.  When she recognized who it was,
she laughed.  "Dalton!  Liebchen!  What are you doing?"

She was drunk.  And now full of heroin as well.

"Take me back to the castle with you."

"Of course, Liebchen.  Did your car break down?"

"The baroness has my daughter," he said in an even voice.

"But--" "I'm going to get her back.  I need your help."

"Why?"

"Let's go.  Right now."

"It's too early.  I was going to visit a girlfriend."

"Drive us back to the castle."

Katrina whined.  "Let's go have some drinks first.  I've been so bored
all day.  And Aldous has been a bastard.  And I feel like fucking,
Liebchen.  We can do it at my girlfriend's.  She wouldn't mind--"
"Now.

Let's go."

"But Liebchen--" "Now, goddamnit.  Let's go."  Stewart brought the
pistol up into view and pressed the muzzle against her neck.

Katrina began to cry.  "Please take the gun away, Liebc7en."

"Start the fucking car."

The twelve-mile drive to Schloss Vogel was mostly a silent one, with
Stewart crouched behind Katrina, holding the pistol to the back of her
neck, and Katrina whimpering sporadically.  Twice she nearly went off
the road.

When the gate came into view, Stewart gave her his instructions.  Once
through the gate, she was to drive up to the portico, stop the car, and
hand him the keys.  They would go in together, with him holding the
pistol on her.  She was going to have to be his hostage, he
explained.

He was going to hold the pistol at her neck until the baroness turned
Genny over to him.

He had planned for Katrina to drive him and his daughter back into
Regensburg, but she was too unstable to risk it.  Instead he'd let
Katrina drive them down into the village, put Katrina out on the
street, and drive Genny to Regensburg himself.  There they could
transfer to his rented VW and drive back to Munich.

"But the baroness knows you won't shoot me," Katrina protested.

"You'll have to persuade her that I will."

"Liebchen, please.  I can't do it.  I don't feel well."

"You'll feel a hell of a lot worse if you don't.  Let's go."

An electronic device at the gate identified Katrina's car and the gate
rolled open.  She threw the car into first gear and roared through,
throwing up a shower of white pea stones behind the wheels.

"The baroness will be so furious," Katrina sobbed.  The driveway turned
sharply, and Katrina steered the car drunkenly onto the narrow dirt
shoulder and almost into the ditch.  Stewart grabbed the wheel with his
free hand and pulled the car back onto the drive.

"She won't care if you shoot me or not," Katrina blubbered.

"She won't believe you.  She'll tell you to go ahead and shoot me."

Stewart didn't bother to reply.  The drive sloped upward across an open
lawn and then leveled out as it neared the portico.  Suddenly the
castle's outside spotlights blazed on.  There were several dozen of
them, mounted on the portico, on the castle turrets, and along the high
walls of the keep.  They bathed a large area of the lawn and driveway
in bright light.

Katrina tromped on the brakes and the Mercedes skidded to a halt fifty
feet short of the portico.  She dropped her head down against the
steering wheel.  "I can't do it, Liebchen.  The baroness will be so
furious!

Stewart jabbed the pistol barrel behind Katrina's ear.  "Start the
car!"

Katrina shook her head.

Stewart heard something slap lightly against the door.  He glanced
out.

Two Dobermans had come up alongside.  They pressed their muzzles
against the bottom of the window.

Suddenly Katrina yanked the keys from the ignition and opened the
door.

Stewart grabbed for her coat collar but came away with a fistful of
fur.  She rolled out, scrambled clumsily to her feet, and bolted for
the portico.  One of the Dobermans lunged at her, sank his teeth into
the trailing edge of her coat, and pulled her down.

Katrina screamed with terror.

Stewart climbed over the seat and groped frantically for the door
handle.  He found it and slammed the door shut, grazing the snoot of
the second Doberman in the process.

Anne sat in the room for several hours.  She wrote nothing on the pad
of legal paper provided for her.  She wondered how long they would
wait.

Was she being stupid?

Repeatedly she was tempted to concoct a page of phony information, if
only to get to see her daughter, but she hesitated.  In the long run it
might prove a bad idea.

But she felt that if she didn't do something soon, she would collapse
from the mental strain.  The baroness had tremendous advantages in the
situation.  All Anne had was a few bits of information the baroness was
determined to have.  As soon as she gave those away, she would be
completely at the woman's mercy.

She paced the room, trying to decide what to do.

Footsteps and voices erupted in the hall outside.

The door opened.  The baroness's two thuggish bodyguards, Hans and
Wolfgang, looked in.  Then Karla stepped into the room.  Behind her was
the baroness.

Anne had not seen her since the night of the dinner party on Long
Island many months ago--the night the baroness had informed her that
she had been used as a guinea pig by Harold Goth.  The night she had
moved out on Dalton Stewart.

The woman looked older than Anne had remembered her.  And haggard.

There were heavy circles under her eyes, and the once barely noticeable
wrinkles at the corners of her mouth and eyes had deepened.

nne remained standing by the window.

404

"You have written out the information, ja?"  the baroness said.

Karla went over to the desk and looked at the legal pad.  "Gar nichts,"
she murmured in a shocked whisper.  Nothing at all.

The baroness strode heavily across the room and slapped Anne across the
face with great force, snapping her head to the side.

Anne gasped and brought a hand up to her cheek.

"You are a stupid, stubborn woman, Frau Stewart!  If you want to see
your daughter I would suggest you get busy immediately.

Do you understand me?"

Anne stared at her without speaking.

The baroness called out in a loud voice for Hans and Wolfgang.

They came quickly into the room.  The baroness spoke to them in a rapid
monotone.  Anne saw Karla's face become quite pale.

The two men seized Anne by the arms and dragged her down four flights
of stairs to the dungeon in the subbasement.  She didn't resist.  They
pulled open the door to the little maiden, positioned her inside,
closed the door, and screwed it tight.

Anne stood inside the device, more astonished than frightened.

How could the woman do something like this?  What did she hope to
accomplish?  Was she crazy?

At first Anne didn't know what was supposed to happen to her.

She could feel the pointed spikes in front and in back of her; but as
long as she stood exactly in the middle, nothing touched her.

She looked up.  There were four small airholes in the top, about six
inches above her head.  Except for the tiny amount of light visible
through those holes, she stood in complete darkness.

After a few minutes the nature of the ordeal she faced began to dawn on
her.  The iron box was about two feet in width and depth and six feet
in height.  She could not sit, kneel, or lie down.

And the spikes prevented her from moving more than a few inches in any
direction.  All she could do was stand in one place.  For the first
hour or so, this would not seem like much of a punishment; but after
three or four, the need to sit or kneel would become overwhelming.  Her
knees would tire and buckle, or she would faint.  Then the real torture
would begin.

She wondered how long the baroness dared to leave her there.

Five minutes after Genny climbed back up through the hole in the floor
and repositioned the bed over it, some food was brought to her.

Two men stood in the doorway holding rubber truncheons while a third
carried in a covered tray, put it on the table by the window, and
hurried out.

Genny pulled the cover off eagerly to view her meal.  Along with a
glass of milk and a slice of black bread, there was a dish with a
greasy fat sausage on it, a pile of limp, smelly cabbage, and another
pile of cooked, sliced potatoes in an oily dressing.  Genny consumed it
all.

As soon as she had finished the meal, fatigue overcame her.  She lay
down on the bed and fell immediately asleep.

She awoke several hours later refreshed but still hungry.  She hoped
the next meal would taste better.  Maybe they'd include a dessert.  She
loved desserts best of all.  Mommy would never let her eat very many,
though--only on special occasions.  And she would never ever let her
eat any candy.  It was about the only thing about Mommy she didn't
like.  Except for that, she loved Mommy more than anyone in the
world.

She promised herself that she would never be mean to her or refuse to
do anything she asked her to do--ever again.  She would never eat
another dessert in her whole life if Mommy didn't want her to.

Genny stiffened.

The faintest trace of a familiar odor--barely a few molecules of
it--tickled her nose.  Excited, she rushed to the door and pressed her
nose against the narrow crack between the bottom of the door and the
floor.  Her nostrils were overwhelmed by the scents of floor wax,
stain, and various chemicals.  She got up and walked back to the bed
and sat on the edge.  She couldn't pick up the scent anymore.

But a few minutes later she smelled it again.  She crawled under the
bed and put her face over the hole in the floor.  It was coming up from
the secret passageway.  It was very faint, but there was no mistake
what it was.

Mommy was here, somewhere inside the castle!

Genny got up on the bed and jumped up and down, shrieking for joy.

Mommy was here!

She ran excitedly back and forth between the window and the door, over
and over again.  Finally, exhausted and out of breath, she sat back
down on the bed.  Why was it taking her so long?

An hour passed, and Mommy didn't come.  Finally she heard footsteps
coming toward her door.  Her heart started pounding so hard she thought
it was going to fly out of her chest.

The door opened and she ran toward it.

The same three men had come back again.  But Mommy was not with them.

They left her a dinner tray, picked up the lunch tray, and departed.

After a few minutes Genny went over to look at what was under the
cover.  Some kind of goulash with noodles and more cabbage.  No
dessert.  She ate the slice of bread, drank the glass of milk, and then
started to cry.

They weren't going to let her mother come get her.  She had to do
something about it, right away.

Genny pulled the flashlight out from under the mattress and then pulled
the down quilt off the bed.  She pushed the bed aside and stuffed the
quilt through the hole in the floor.  Before she dropped it, she held a
corner and let it fall out as far as it would go.  When it was hanging
straight down, she released it.  It fell in a nice pile directly under
the hole.  She then grabbed the pillow from the bed and stuffed that
through the hole as well.  It landed on top of the quilt.

Now all she had to do was drop herself down on top of them.

Then she was going to find Mommy, and she and Mommy were going to get
out of this awful place.

With her hands and teeth she ripped the mattress apart and made a big
pile of the stuffing over by the window.  She threw the mattress
ticking over the loose down and feathers, then maneuvered the table
across the floor until she had it centered over the pile.  For good
measure, she ripped the curtains from the window and dumped those on
top of the table, along with the towels from the bathroom.

She was about to throw the sheets onto the pile as well when another
idea occurred to her.  She ripped a narrow strip from one end of a
sheet, threaded it through the metal loop on the base of the
flashlight, knotted it, and draped it around her neck.

Genny fetched the box of matches she had taken from the basement repair
shop, then cranked the casement window open as far as it would turn.  A
chilly breeze blew into the room.  She struck one of the matches
against the side of the box and held the flame against the ticking.  It
went out.  She tried three more.  The fourth one worked.  The ticking
smoldered for a few seconds and then caught.  A dense cloud of smoke
began to darken the room.

Genny pulled the bed back into place over the hole.  The longer it took
them to find it, the better, she decided.  She crawled under the bed,
swung around, and stuck her legs down into the hole.

She turned on the flashlight and braced herself on the edge with both
hands.  She took one last look at the smoking pile of mattress
ticking.

The mattress cover had caught, and orange flames were spreading rapidly
across its surface and licking at the underside of the table.

Genny eased herself down until she was entirely through the hole,
clinging to the edge of the floor by her fingers.  Then she let go.

Half a dozen dogs milled around Katrina, snapping and growling.

Repeatedly she tried to get to her feet, but each time the dogs pulled
her back down.  Her screams continued, but they were losing volume.

Stewart could not understand why no one had come out to rescue her.  He
slid the safety catch on the pistol and pressed the button to roll the
window down the inch or two he needed to stick the barrel out.

Nothing happened.  Katrina had taken the key.  Without the ignition on,
he couldn't open the windows.  He looked down.  One dog remained by the
door, baring his teeth at him.

Stewart took a chance and opened the door a crack.  The Doberman
immediately pressed his muzzle through and twisted his head sideways,
trying to widen the crack.  Stewart placed the pistol against the dog's
head and pulled the trigger.

The explosion rocked the car and filled the interior with the acrid
stink of gunpowder.  The dog was gone.  Stewart's head rang.

He opened the door further and tried to aim at the dogs mauling
Katrina.  At this range he couldn't shoot without risking hitting
her.

He fired two shots over their heads anyway, hoping to panic them into a
retreat.  The dogs jumped at the noise, then continued their attack.

Her screams had subsided to a choked, sobbing wail.  Stewart couldn't
stand it.  He got out of the car and ran over to her.  He dropped to
his knees and quickly shot two of the dogs at pointblank range.  He
aimed at a third, but another dog clamped his jaws on Stewart's right
arm and pulled it down.

Stewart transferred the pistol to his left hand and shot the dog in the
chest.  More dogs came toward him.  Katrina rose to her hands and knees
and tried to crawl away.  Her fur coat, except for a sleeve and part of
the back, had been ripped off.  A low gurgling moan escaped her mouth;
then she was silent.  One of the dogs seized the back of her neck
between its jaws and pinned her down on the grass.  Stewart shot the
dog in the head from behind.  The animal yelped and collapsed.

Katrina didn't get up.

Stewart ran back to the car.  He jammed his fist against the horn and
held it there.  He could see people at many of the windows, but still
no one would come out.

Two more dogs ran over to Katrina's inert form.  Stewart opened the car
door and fired at them.  Neither bullet hit, but both animals bounded
off, yipping loudly.

He counted the dead dogs.  At least five.  He could see five or six
more lurking in the shadows behind the portico, uncertain as to their
duty.

He jumped back out of the car and ran over and knelt down by Katrina.

She was unconscious but still breathing.  The flesh of her face and
neck showed puncture wounds and long gashes.

Blood was oozing out of her from a dozen places.

Stewart picked up a large shred of the fur coat and felt in its pocket
for the key to the car.  Four of the dogs came out from the shadows of
the portico and moved toward him.  Instead of lunging at him like the
others, they were showing a little caution--and some cleverness as
well.  They spread out, like a hunting party, and began creeping toward
him, ears back and bellies low to the ground, from four widely
separated directions.  He saw a fifth dog emerge at a trot from behind
the portico and circle around behind the car.

Stewart grabbed two other pieces of the coat from the driveway, looking
for the second pocket.  He found it, but the key was not in that one,
either.  It must have fallen out.

He stood up, walked a few paces toward one of the advancing dogs,
stopped, took careful aim, and pulled the trigger.

Instead of the explosion of a departing bullet, all he heard was the
dull metallic click of the firing pin striking an empty chamber.

Genny landed feetfirst on the pillow, then rolled over onto her side.

She stood up, completely unhurt, pulled the flashlight from her neck,
and shined it around the floor.  The sword was where she had left it.

She picked it up and started down the passageway.

She covered the length of the upper level as fast as her little legs
would carry her, stopping a few seconds to hold her nose against each
door, hoping to catch a trace of her mother's scent.

She reached the end of the passage and ran down the narrow stairs to
the next level below.  Whatever thin traces of her mother's presence
remained in the air, they were being rapidly overwhelmed by other,
newer scents.  The sounds of running feet seemed to reverberate
everywhere through the ceilings, walls, and floor.  And she could hear
loud voices now, coming from different parts of the castle.  They've
found the fire, she thought.

On the lower floor, she stopped to hoist herself up the wall and look
through one of the peepholes.  Lights were on.  She could see the backs
of women at one of the windows, watching something outside.  Mommy was
not among them.

Genny reached the steps leading to the basement and stopped.

Someone was coming up.  She could hear heavy footsteps and see the
fleeting shaft of a flashlight beam.  She fled back up the stairs to
the upper floor and retreated across the top level all the way to the
corner.  There she stopped.

The ceiling of the passageway beyond the corner was on fire.

It had already burned through the floor above and was eating its way
rapidly along the ancient, dust-dry timbers and planks.  While she
watched, a chunk of burning wood fell on the pillow and quilt she had
thrown down through the hole.  The bedding burst quickly into flame.

Genny ran back down the stairs to the floor below.  At the corner she
switched off her flashlight and listened.  The man who had come up from
the basement was advancing slowly along the passageway, sweeping the
dark with the beam of his flashlight.

Genny ducked her head back just before the light caught her.

She was trapped, now, between this man and the fire in the passage
above.  She knelt down, turned out the flashlight, gripped the sword
firmly with both hands, and waited for him.

Anne tried to keep her spirits up with anger, but she could feel her
strength rapidly ebbing.  She shifted from one foot to the other and
tried to pretend that she was going for a walk, but so close were the
pointed tips of the spikes that even that minimal amount of movement
brought them sharp against her flesh.

She tried using the pain by pressing her knees against the tips so that
the sting of their points could stimulate her fatigued muscles.  But
that tactic was no longer working.  Her legs were beginning to burn
from the stress.

She found that if she put her arms down straight at her sides and moved
them slightly back until she could wrap each hand around a spike at
about mid-thigh level, she could temporarily take some of the weight
off her feet.

But it was only a matter of a little more time before her legs would
refuse to hold her upright.

Stewart turned and ran for the car, then stopped.  One of the Alsatians
had planted itself directly in front of the opened door.

The dog's eyes were fixed on him.  Its lips were drawn back, exposing
its long rows of incisors in a mock grin.  A guttural snarl issued from
its throat.

The other dogs were patiently encircling him.  He felt mesmerized,
watching them.  They spread out and approached him obliquely, trotting
back and forth in a zigzag pattern to narrow the gaps between them so
he could not slip through.

He knelt down, one eye on the dogs, and ejected the empty clip from the
pistol's grip.  He laid the pistol and clip on the ground while he
fumbled for the box of extra bullets in his pocket.  His kneeling
emboldened the dogs.  They approached at a trot.  He tore the box open,
snatched up a handful of bullets, and started forcing them into the
clip.  Several spilled to the ground.  He couldn't see what he was
doing.  He managed to get three in the clip.  The dogs were getting too
close.

He pulled off his coat, grabbed the pistol and the clip, and ran.

The lawn sloped directly to the vineyards and the trees beyond.

If he could make it to the trees, he could climb up out of their
reach.

He ran as he had not run since he was a little boy--with the full-out
abandon of despair.  He strained to force his limbs to move faster than
they had ever moved.  The rush of energy bore him, weightless, over the
ground.

He knew the dogs were right behind him, but he couldn't hear them.  His
ears were filled with the sound of his feet hitting the earth and the
noise of his heart pounding under his ribs.  The trees, faintly
illuminated by the castle's spotlights, looked a long way off.  He
tried to jam the clip into the pistol on the run, but couldn't manage
it.

The lawn darkened beneath his feet and came to an end.  He was in the
vineyard now, rushing between rows of vines.  The trees at last were
getting close.

A sudden tug at his sleeve.  The clip slipped from his hand and fell.

He tried to increase his pace.  His lungs sucked in the air in loud,
gasping gulps.

He thought of a fox hunt long ago in Leesburg, Virginia; the owner of a
pharmaceuticals company had a big horse farm there.

He remembered the fox zigzagging across the field, a reddish blur in
the morning light, the hounds of death baying on its tail.

Teeth snapped at his left hand.  He felt a momentary sting and then
nothing.  Two were running abreast of him now.  He could hear them
slapping against the branches of the vines on each side of him along
the narrow path.  He threw the pistol at one and heard the weapon thud
into the soft vineyard soil.

The dogs were closing in, snapping hungrily at his heels, his arms.  He
wanted to slow down before his lungs burst, but the trees were still so
far away.

A heavy weight crashed against his back.  A momentary sensation of a
warm breath on his neck, of claws digging into his shoulders.  Jaws
captured a pants leg.  He tried to shake them off and keep straight on
for the trees, but the sudden tug threw him off stride.

He pitched forward, between the rows of vines, and the dogs crowded
over him, whimpering in their eagerness.  He could smell them, hear
them, see them, feel them.  They were at his neck, his chest, his arms,
his legs.

He flailed and screamed.  He felt the weight and pressure of the bites,
the warm release of his blood.

His heart hammered mightily.  His senses felt so sharp.  He glimpsed
the stars in the sky brighter and bigger than he had ever seen them.

And behind the spots of light around the castle walls he saw a bright
red fire burning.

He remembered fireworks on the Fourth of July when he was a boy--how
the vivid noise and color, building to a crescendo, had once stirred
his soul--God, so long ago.

His last thoughts were of his daughter, Genny.  His heart filled with a
bitter sorrow.  He would never know now what would become of her.  His
heir, his flesh and blood, and he had failed her, just as his father
had failed him.

Genny could still hear someone in the passageway.  A flashlight beam
shined down the narrow passage and splashed against the wall right next
to her.  Once, she heard him come almost to the corner, then turn
back.

A long time seemed to pass.  People were running and shouting all
through the castle.  Genny could hear the fire crackling above her.

The air in the passageway was getting hot.

She expected to hear fire sirens and fire engines coming up the
driveway, but none did.

She began to feel afraid.  She had to find Mommy.  She peeked around
the corner.  It was dark.  The man had gone.  She stood up, turned on
the flashlight, and started back along the passageway.

She reached the far end and was about to start down the steps to the
cellar when she heard him coming back up.  He was shouting in German.

Someone was with him.  Genny caught a whiff of the baroness's
perfume.

Then she heard her voice.

She turned and headed back around the corner.  The sword fell from her
hands and clanked on the passage floor.  She scooped it up and
continued.

At the stairs to the upper floor she paused.  She didn't want to go
back up.  The fire was getting loud and hot.  Smoke was billowing down
the stairs.

She trained the flashlight on one of the big crossbeams over her
head.

If she could get up there, they might not see her.  She let the
flashlight hang from her neck on its ribbon of torn sheeting and tried
to decide what to do about the sword.  She couldn't carry it, because
she needed all her fingers free to climb the wall.

The man and the baroness were getting closer.  Genny could smell the
peculiar odor of the drug that the woman had injected in her earlier.

The baroness must be bringing it to inject her again.

Genny slipped the ribbon of sheet off over her neck, twisted it around
the hilt of the sword, then draped the whole affair back over her neck,
positioning it so the flashlight hung down in front and the sword down
in back.  The weight of the sword immediately pulled the ribbon up
tight against her throat, but that was just as well, since it brought
the flashlight into a better position for her to see.

She braced hands and feet against the walls and started up.  She
managed the first few feet quickly, keeping herself in place by dint of
sheer strength; then she couldn't find a toehold.  She slid a foot up
repeatedly, groping in the dim light for some slight depression in the
stone surface.

A piece of the wall under one foot crumbled away beneath her, and she
fell.  The sword twisted around and wedged itself between the walls,
nearly choking her on the ribbon as she fell past it.  The ribbon tore
loose and the flashlight bounced against the wall, hit the floor, and
went out.  The sword followed, clanking down in the dark, narrowly
missing her leg.

Genny felt around frantically for the flashlight, found it, but
couldn't get it to come back on again.  The baroness and the man were
very close.  They had stopped talking.  They must have heard her
fall.

No time to find the sword.  She braced her hands and feet against the
walls again and started up.  This time she found footholds all the
way.

A red glow from the fire above filtered down the stairs through a
swirling haze of smoke at one end of the passage.  In the other
direction, the beams from the two flashlights played along the walls.

Genny stopped.  She could see the crossbeam now.  She was just about
level with it, but it was well to one side and out of her reach.

Both of them came around the corner and passed directly under her.  The
baroness was holding something that looked like a pistol.

They hesitated when they reached the stairs.  Then the baroness
squeezed past the man and started up.  From the top she shouted
something in an alarmed voice.  The man turned and retreated back along
the passage.  The baroness came quickly down the steps and hurried to
catch up to him.

Genny felt her foot slip.  She pressed it harder against the stone.

The baroness saw the sword and stopped directly underneath her.

After a moment's hesitation she kicked it to one side.

The rock under Genny's foot came loose and crashed to the floor.

The baroness whirled around.  She pointed the flashlight upward and
caught Genny in its beam.  Genny let herself drop.  The moment she hit
the floor she recovered her balance and ran toward the stairs.  The
smoke and heat coming down from above were too strong for her to go any
further.

The baroness hurried toward her, pointing the pistol and talking
soothingly.  Genny felt something sting her left shoulder.  She slapped
against the spot reflexively and felt the shaft of a tiny dart.  She
jerked it out quickly and threw it to the floor.

The baroness stood in the passage, ten feet away, shining the beam in
Genny's eyes and waiting.

Genny put her head down and lunged forward.  She struck the baroness in
the legs and knocked her off balance, but as she tried to squeeze past
her in the narrow space, the baroness smashed the butt of her
tranquilizer pistol on her head and knocked her down.  Before Genny
could recover, the baroness delivered a hard kick directly against her
chin.  The little girl howled with pain and rolled over onto her
stomach.  She took two more blows against the back of her head.

Before the baroness could land a third, Genny scrambled to her hands
and knees and crawled back toward the stairs.  The tranquilizer dart,
despite the speed with which she had removed it, was making her
groggy.

She reached the bottom of the stairs and stopped.  She looked behind
her.  The baroness had put down her flashlight and was kneeling on the
floor, reloading the tranquilizer gun.

Genny came running back.  In the dim light she could make out the
silhouette of the jagged piece of rock that had fallen from the wall.

She knelt and grabbed it.  It was about the size of a softball.

She threw it as hard as she could.  It struck the baroness in the
face.

The woman fell sideways.  Her shoulder hit the wall and spun her
around.  She threw her arms up, then toppled backward onto the floor.

Her foot kicked the flashlight and sent it rolling along the passage.

Genny snatched up the flashlight and then jumped over the baroness and
grabbed the sword, lying near the wall a few feet away.  The baroness
was on her back.  Her eyes were open.  She appeared conscious but
dazed.  Genny set the flashlight on the floor, wrapped both hands
tightly around the sword's handle, and drove the fat blade through the
baroness's stomach.  The tip struck her almost precisely at her
navel.

It ripped easily through cotton blouse and silk slip, through flesh and
stomach walls, and came to rest firmly wedged against the inner surface
of the spinal column.

The baroness groaned.  Her hands came up, felt the blade of the sword
impaling her, then dropped back.  She cried out in a hoarse, quavering
voice.  Her eyes fluttered closed, then opened.

She found the strength to grab the blade of the sword again.  She
pulled at it with one convulsive effort, and the sword came free,
clattering on the stone.  The baroness raised herself on her elbows.

Blood bubbled from her stomach.  She screamed again, louder.  She
gasped for breath, then screamed again.

Genny picked up the flashlight and ran as fast as she could.  She
reached the long steps to the basement and hurried down them.

At the small closet she paused and listened.  She could still hear the
baroness, far above her.  Her scream had lost power; it sounded like a
sorrowful moan.  Genny aimed the light in both directions down the
basement corridor.  No one was in sight.  All the lights were out.

She ran through the basement until she found steps up to the ground
floor.  It was dark there as well.  People were milling around,
shouting.  Stray beams from other flashlights crisscrossed the floors
and walls.  Everyone seemed intent on getting out.

Genny saw light beyond the windows.  The whole outdoors flickered in an
orange glow from the castle's burning roof and upper stories.

Genny wandered through the pandemonium, not knowing what to do.  Traces
of her mother's scent were impossible to isolate.  Smoke was
overpowering everything.  She clambered up the main staircase and ran
through the halls, looking in every room.

She picked up the scent again.  She followed it to a bedroom down the
end of a long corridor.  The door was open, and the scent was strong,
but Mommy was no longer in the room.  She must have gotten out with
everybody else, Genny decided.

She raced back downstairs and made her way to the front entrance.

People were crowded under the portico, crying and shouting at each
other.  No one paid any attention to her.  She wondered why they stayed
there and didn't go out onto the lawns.  She squeezed through, trying
to discern her mother's scent from the confusion of odors around her.

She couldn't find it.

She saw why no one was leaving the portico.  Both exits were barred by
the huge portcullises.  Out on the lawn men with tranquilizer guns were
shooting at the dogs.

Someone shouted something.  The others cheered.  The portcullis gates
on both sides of the portico started clanking upward, and everyone
surged out onto the driveway and the lawns.

Genny looked at every face.  Her mother was not among them.

Dozens of fire trucks, police cars, and ambulances came racing up the
driveway, their sirens wailing mournfully in the night air.

Genny ran back inside.  She hurried through the echoing dark rooms on
the ground floor, swinging the flashlight from side to side.  She
screamed "Mommy!"  over and over again at the top of her volce.

No one answered.

Ladders went up the side of the building.  Bright emergency lights came
on.  Firemen were coming in with lights, masks, tanks, axes, and
hoses.

One saw Genny and ran toward her.  "Auskommen, Madchen!  Auskommen!"

he yelled.

Genny switched her flashlight off and ran around a corner into the dark
before he could catch her.  Other firemen joined the chase.  Eventually
they cornered her in a pantry off the main dining room, grabbed her,
and dragged her outside.  She kicked and screamed.  "Mommy!  Mommy!

Find my mommy!"

Out on the portico she slipped free and ran out onto the lawn.

Satisfied that she was out of harm's way, the firemen turned their
attention elsewhere.

The moment they were out of sight, Genny slipped back inside.

There was still the basement, she realized.  It took her a while to
find the stairs again.

She rushed down and ran through the warren of subterranean chambers,
calling out for her mother in a tear-choked voice.

Then she caught the scent.  "Mommy!"  she screamed.

"Mommy!  " She had to force herself to slow down and follow the
scent.

She sniffled repeatedly to clear her nose.  She felt very tired, very
groggy The scent trace took her along a low, narrow passage to a set of
old stone steps.  She ran down them as fast as she could.  At the
bottom the scent was stronger.  She called out again but got no
answer.

The scent was strongest by a big iron chest at the back of a
low-ceilinged chamber full of strange, unfamiliar objects.

"Mommy!  Are you in there?"

No answer.

Genny shined the flashlight over the front and saw the two
screw-latches.  She twisted the bottom one open.  The top one she
couldn't reach.  She looked around.  No chairs.  Nothing to stand on.

She ran all the way back up the steps and through the basement until
she found a wooden crate.  She lugged it down to the dungeon, propped
it in front of the Little Maiden, and attacked the top screw-latch.  It
required considerable strength to turn it.

She finally worked it free.  She jumped down and yanked on the door.

Her little body was soaked in perspiration.  The door came open at
last.

Her mother stumbled forward half a step and fell on top of her.

Genny rolled her over.  There was blood on her clothes.

"Mommy!  Are you all right?"

"Can't walk," she whispered.  "Go get help."

"I can't!  They don't understand me.  They won't let me come back."

"Stay with me, then, darling."

"But Mommy, we have to get out!  The castle's on fire.  Can't you
crawl?  I'll help you."

Anne tried to crawl, but her knees, swollen from the hours of standing
and punctured by the maiden's spikes, were too stiff to move.  She
asked Genny again to go find help.

Genny grabbed her under the arms and dragged her across the dungeon
floor to the bottom of the stone stairs.  A stream of foul black water
was now running down the steps.  It quickly soaked Anne's clothes.

Tears started down Anne's face.  Once again she told Genny to go get
help.  But Genny just shook her head.  She put the flashlight in her
mother's hand, got up on the first step behind her, locked her arms
around under her, and dragged her up the step.

Step by step, inch by inch, she pulled her mother up.  Water, pumped by
the firemen onto the castle's walls and washed through the burning,
centuries-old timbers, ran down the steps in a torrent now, its foul
stink blending with the acrid stench of the smoke.

Genny slipped on the stone and the water carried them down half a dozen
steps before could gain a secure foothold again.  Anne tried to help,
but she simply couldn't move her legs.

Genny began to feel dizzy and weak.  She sat down behind her mother and
rested for a few minutes.

Then she redoubled her effort.  And this time, after an eternity of
tugging and pulling, sitting and resting, tugging and pulling, she
succeeded in reaching the top step.

She dragged her mother off to the side to get her out of the path of
the water, and again sat down to recoup her strength.

The tranquilizer seemed to be hitting her harder now that she had
expended so much adrenaline.

Despite the long struggle up the steps, they were only as far as the
basement floor.  Water was gushing down from hundreds of places in the
ceiling.  A tremendous crash overhead shook everything around them.

Part of the castle had collapsed inward.  They couldn't go upstairs.

Genny remembered the fresh air she had smelled near the area with the
fireplace wood.  Gathering herself for one last exertion, she took hold
of her mother again and dragged her backwards through the maze of
cellar passages until she found the place where the wood was stored.

A short distance beyond was the door.  It was barred by a big hardwood
plank resting in iron brackets.  Genny lifted the plank off and yanked
the door open.  Outside there were more stone steps.  A gust of smoky
air swirled in.

Straining for a few last dregs of strength, Genny tried to pull her
mother through the bulkhead doorway and up the cellar steps.

They were so close to freedom now, so close to safety; but the child
had already exerted herself beyond even her incredible powers.  She had
nothing left.

She sat with her arms wrapped around her mother from behind, and rested
her shoulder and head against the side of the bulkhead and closed her
eyes.  "I'm sorry, Mommy," she whimpered.

Near dawn the firemen found them, unconscious at the bottom of the
bulkhead steps.  The blaze had at last been extinguished.

The castle's interior had been completely gutted by the fire, but the
exterior walls still stood.

A rescue crew moved them quickly by ambulance to a hospital in
Regensburg.

Anne held up a hand to shield her face from the sun.  She was sitting
on the deck of Lexy's summer house on the Maine coast.  It was a warm,
clear day in late August, and the waters of the bay were unusually blue
and serene.  A couple of fishing boats were visible on the horizon, and
a big, two masted schooner was tacking out of the harbor against a lazy
wind.

Anne was near the end of a long convalescence.  Only a few small scars
were visible on her knees and her shoulders as evidence of her ordeal
at Schloss Vogel.  Emotionally, she was still fragile, but each day she
felt stronger.

"I really don't want to write a book about it," she said.

"You'll make a fortune," Lexy insisted.

"I can't write, for one thing.  For another, I don't want the world to
know.  For Genny's sake.  She's got to grow up with this."

Lexy refilled their wineglasses.  "We'll get you a collaborator.

That's the way books get written these days.  And you can just leave
out whatever you don't want the world to know.  If you don't write it,
someone else will.  And then you'll have no control over the
material."

"Who else could tell the story?"

"Hank Ajemian, for one."

"Hank doesn't ever want to think about it again."

425

Lexy grinned.  "That leaves me," she said, jabbing a thumb at her
chest.

Anne laughed.  "I suppose you'll want a part in the movie version,
too."

"And why not?  You don't dare tell me I don't deserve it.  After
delivering that superbaby of yours on the dark earth beside a burning
building in the Caribbean on New Year's Eve?  After helping you steal
the Jupiter file from Dalton's office safe?"

"And I'll be forever grateful."

"By the way .  . . are there any copies of Jupiter left anywhere?"

"I don't know.  But it doesn't matter.  No one has the access code
except me."

"What about that guy at IBM?"

"Axel Guttmann.  Yes, that's true.  He has it."

Lexy tapped a fingertip against her wineglass and looked knowingly at
Anne.  "Did you keep a copy of Jupiter?  Tell me the truth."

Anne didn't reply.

"I thought so.  What're you going to do with it?"

"I'm going to go back to school first, get a doctorate.  Then I'll
think about it.  It should be studied.  But it's so dangerous, I don't
know who I could ever trust with it."

"Don't trust anyone.  And don't study it.  Deep-six the damned thing.

It's cursed.  Think about yourself.  Write a book.  Become a
celebrity.

Have some kicks."

"I'd rather be a scientist."

Lexy yawned.  "You could be both.  But you're probably right.

Being a celebrity is awfully tacky these days, anyway."

"What's Genny doing?"

"Getting something to eat, as usual.  That child of yours has the
appetite of a starving elephant.  I swear she must consume ten thousand
calories a day."

"She has a fast metabolism."

"Part of her Jupiter profile?"

"Probably.  God, Lexy, I worry all the time what'll become of her.  Her
playmates already know she's different."

Lexy laughed.  "I'd worry more about her playmates, if I were you.

Thank God she has your modest, agreeable disposition.  Otherwise I'd be
afraid of her myself."

A car turned off the road and came slowly up the driveway on the other
side of the house.  Lexy leaned out of her beach chair and looked
around.  "Oh, listen.  I've asked someone over for dinner.  That's
him.

He wants very much to meet you.  I hope you don't mind."

Anne groaned.  "What is this one?  A rich, divorced Maine lobster
fisherman?"

"I guarantee you'll be crazy about this guy," Lexy said.  "He's great
company and he's dying--and I mean absolutely dying--to hear your
story."

Anne heaved a sigh.  She slipped her terry-cloth robe on over her
bathing suit, then pulled her sun hat down over her face.  "I'm not
even presentable."

Lexy snickered.  "Don't go anywhere.  I'll fix him a drink and bring
him out."

Ten minutes later Lexy appeared with the male friend in tow.

She was giggling like a prankish schoolgirl.  Anne pushed up the brim
of her sun hat to get a look.  She saw street shoes and then an
exceptionally wrinkled wash-and-wear summer suit.  The man wearing them
had dark hair.  He was very tall, with a sensitive face and pleasant
eyes.  He looked embarrassed.

"Anne, I'd like you to meet Dr. Paul Elder.... You may remember him
from a previous lifetime."

Their eyes met.  Both started to say something at the same time, and
then stopped.  Their faces turned red.

Lexy shook her head in wonderment.  "Boy, I can see we've got a couple
of real party animals here."  She turned back toward the house and
bawled out at the top of her voice: "Genny!  Come on out here and say
hello to your future stepfather!"

Ambassador Mishima beamed.  The soft flesh of his face was suffused
with a luminous glow, as if lit by some internal power source.

He had a right to be proud, of course.  This was his project as much as
anyone's.  He had pushed for it, and continued to push for it--at great
personal risk to his reputation--when others were long past giving
up.

"How many babies?"  he asked, looking through the glass walls of the
center's big new maternity suite, built specifically for this
occasion.

"Forty," Yamamoto answered.

"And all healthy?"

"Five died.  The rest are healthy."

"We'll have to wait for tests, of course," Mishima said, more or less
rhetorically.

"Yes ."

"But this is very promising.  Wouldn't you agree?"

Yamamoto nodded.  "Very promising.  The genomes all conform to the
results--exactly as projected."

Mishima scratched his cheek thoughtfully.  "We should begin varying the
sequences of the new genes with the next batch.

Let's not rest on our laurels.  Let's find out how far these new genes
can be pushed.  Or perhaps I should say these new old genes."

Yamamoto nodded.

"There is no new thing under the sun," Mishima said, with a broad
grin.

"Ecclesiastes."

"I'm sorry?"

"The Christian Bible."

"Oh."

"I want the whole team honored."  Mishima said.

"That'd be fitting."

"It's been a strain on them.  Particularly all these months of
secrecy.

And they are heroes--authentic heroes.  The country owes them a great
debt."

"But the project must remain secret."

Mishima sighed.  "Unfortunately.  I just hope I live long enough to see
the Americans' reaction when we finally spring it on them."

"Not to mention the rest of the world."

The ambassador's expression grew somber.  "Of course.

That too."

Genny picked up a stone from the beach and looked back up at the deck
of the cottage where her mother, Paul Elder, and Lexy Tate were
sitting.  "Watch this one, Paul!"  she shouted.

"Okay.  I'm watching," he said.

"That's the last one, Genny," Anne warned.

Lexy looked at Elder with a sly grin.  "So you're already 'Paul'
now."

Elder shrugged.  "I don't want her to call me 'Doctor."

" Genny whirled around like a shot-putter and hurled the stone far out
over the water.

"Very impressive!"  Elder cried.  "You'll make the big leagues easy
with an arm like that."

"Don't give her any ideas," Anne said.  "She's become a real show-off
lately."

"She's just trying to impress 'Paul,' " Lexy said.

"Just what I need," Anne answered.  "Competition from my three-year,
eight-month-old daughter."

Genny picked up another rock and threw it out over the water.

She looked back.  Paul wasn't watching anymore.  She sighed and
wandered down the beach.  She was happy that her mother and Paul were
together again.  She hoped he really would become her new daddy.  He
was a lot of fun.  And she could learn all about being a doctor from
him.  If she was going to be a doctor.

Right now she wasn't sure; there were a lot of things she wanted to
do.

She found a big white stone half-buried in the sand and pulled it
out.

Another one for her collection.  She tossed it up in the air and caught
it.  It felt nice--smooth and heavy.

She looked back down the beach toward Lexy's cottage.  She wanted to go
back and ask Paul to come and play with her out on the beach, but Lexy
had told her that it was important for her to let Mommy and Paul spend
time together alone.

She didn't see what was so important about it, but she promised Lexy
she would.

Genny wandered further down the beach and then turned onto a sandy path
that ran back to the town road.  There were a lot of bushes here, but
she could still catch glimpses of Paul and her mommy on the porch.

Their heads were very close together.

A white car was parked further up the path.  People used the path to
get to the beach, and it wasn't nice for someone to block it like
this.

She had seen the same car there yesterday, and the day before.

The same two men sat in the front.  One of them was looking at Lexy's
house with a pair of binoculars.

She picked up a few more stones, cradled them in her arms, then ducked
into the bushes and worked her way through the undergrowth until she
was abreast of the car.  She put her rocks down in a pile in front of
her, collected a few more from the ground nearby, and crouched down to
study the men.

One man had a thin, pale face, with big ears and small eyes.

His head was completely bald.  The other man had white hair and ebony
black skin.  Their auras looked scary; they were flickering and jumpy,
constantly changing colors.

Genny didn't know who they were, but she didn't have to.  She
understood that they were bad, and that was enough.

She picked up a rock, stood up, gauged the distance, and let it fly.

It struck the binoculars and knocked them out of the man's hand.

Genny threw another stone.  It sailed through the open driver'sside
window and hit the bald-headed man right in the forehead.

The other man quickly wound up the window.

She threw two more.  The first smashed against the side-view mirror;
the second hit the rolled-up window and shattered it.

The engine started and the car backed up.  Genny grabbed her biggest
stone, the white one, and hurled it as hard as she could.

It shattered the windshield.

The car roared in reverse up the path, swerved crazily out onto the
town road, braked with a loud squeal, slammed into first with a
gnashing of gear teeth, and accelerated off down the road in a screech
of peeling rubber.

Genny stood watching, hands planted on her hips.

If they came back tomorrow, she decided, she'd really get them good.

the end.